Previous Contig 007599:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006P06Sequence611007599 (7)gb:AC006439_15342871e-41Arabidopsis thaliana chromosome 2 clone T30D6 map mi39, complete sequence.>gb:AY236007599 (7)
JMFN008L19Sequence633007599 (7)gb:AC006439_15342871e-41Arabidopsis thaliana chromosome 2 clone T30D6 map mi39, complete sequence.>gb:AY
JMSF039O14Sequence654007599 (7)gb:AC006439_15342871e-41Arabidopsis thaliana chromosome 2 clone T30D6 map mi39, complete sequence.>gb:AY624007599 (7)gb:AC006439_15342871e-41Arabidopsis thaliana chromosome 2 clone T30D6 map mi39, complete sequence.>gb:AY
JMSF044E08Sequence698007599 (7)gb:AC006439_15342877e-41Arabidopsis thaliana chromosome 2 clone T30D6 map mi39, complete sequence.>gb:AY654007599 (7)gb:AC006439_15342876e-41Arabidopsis thaliana chromosome 2 clone T30D6 map mi39, complete sequence.>gb:AY

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006P06- GATATTATGCCAACAACTG
                      ____________________________________________________________
consensus GATATTATGCCAACAACTG
 
. : . : . : . : . : . :
rJMFF006P06- AGAGATCTCCACAAGACCACAACCAAAATGTTGGCTTTCCTTGTCAATATAATGTGCAAT
                      ____________________________________________________________
consensus AGAGATCTCCACAAGACCACAACCAAAATGTTGGCTTTCCTTGTCAATATAATGTGCAAT
 
. : . : . : . : . : . :
rJMFF006P06- CAATCAATTAGTTTAAGAAATAAATACGAATTCTAAGGTGTTTCAATGAGCATATCTTTA
JMFN008L19+ GTTTCAATGAGCATATCTTTA
JMSF044E08+ TTCTAAGGTGTTTCAATGAGCATATCTTTA
                      ____________________________________________________________
consensus CAATCAATTAGTTTAAGAAATAAATACGAATTCTAAGGTGTTTCAATGAGCATATCTTTA
 
. : . : . : . : . : . :
rJMFF006P06- TATCAGATAGTCATAGAATGCAGAGGGAGAACACCAAATTCAAGAACATGGCTACTGTAA
rJMSF044E08- ATAGTCATAGAATGCAGAGGGAGAACACCAAATTCAAGAACATGGCTACTGTAA
JMFF006P06+ ACATGGCTACTGTAA
rJMSF039O14- CCAAATTCAAGAACATGGCTACTGTAA
JMSF039O14+ CAGATAGTCATAGAATGCAGAGGGAGAACACCAAATTCAAGAACATGGCTACTGTAA
JMFN008L19+ TATCAGATAGTCATAGAATGCAGAGGGAGAACACCAAATTCAAGAACATGGCTACTGTAA
JMSF044E08+ TATCAGATAGTCATAGAATGCAGAGGGAGAACACCAAATTCAAGAACATGGCTACTGTAA
                      ____________________________________________________________
consensus TATCAGATAGTCATAGAATGCAGAGGGAGAACACCAAATTCAAGAACATGGCTACTGTAA
 
. : . : . : . : . : . :
rJMFF006P06- TACTTCCTTCCAAAGCAAAGATATTGCATGACAAAAT
rJMSF044E08- TACTTCCTTCCAAAGCAAAGATATTGCATGACAAAATCTTGAAGGGAAATAGAGTGCTAT
JMFF006P06+ TACTTCCTTCCAAAGCAAAGATATTGCATGACAAAATCTTGAAGGGAAATAGAGTGCTAT
rJMSF039O14- TACTTCCTTCCAAAGCAAAGATATTGCATGACAAAATCTTGAAGGGAAATAGAGTGCTAT
JMSF039O14+ TACTTCCTTCCAAAGCAAAGATATTGCATGACAAAATCTTGAAGGGAAATAGAGTGCTAT
JMFN008L19+ TACTTCCTTCCAAAGCAAAGATATTGCATGACAAAATCTTGAAGGGAAATAGAGTGCTAT
JMSF044E08+ TACTTCCTTCCAAAGCAAAGATATTGCATGACAAAATCTTGAAGGGAAATAGAGTGCTAT
                      ____________________________________________________________
consensus TACTTCCTTCCAAAGCAAAGATATTGCATGACAAAATCTTGAAGGGAAATAGAGTGCTAT
 
. : . : . : . : . : . :
rJMSF044E08- AATCTTATCAAATGGAATGTAGGTTTTTGATCCCTCCAGAGAAATTTAACAGGAAAGGTG
JMFF006P06+ AATCTTATCAAATGGAATGTAGGTTTTTGATCCCTCCAGAGAAATTTAACAGGAAAGGTG
rJMSF039O14- AATCTTATCAAATGGAATGTAGGTTTTTGATCCCTCCAGAGAAATTTAACAGGAAAGGTG
JMSF039O14+ AATCTTATCAAATGGAATGTAGGTTTTTGATCCCTCCAGAGAAATTTAACAGGAAAGGTG
JMFN008L19+ AATCTTATCAAATGGAATGTAGGTTTTTGATCCCTCCAGAGAAATTTAACAGGAAAGGTG
JMSF044E08+ AATCTTATCAAATGGAATGTAGGTTTTTGATCCCTCCAGAGAAATTTAACAGGAAAGGTG
                      ____________________________________________________________
consensus AATCTTATCAAATGGAATGTAGGTTTTTGATCCCTCCAGAGAAATTTAACAGGAAAGGTG
 
. : . : . : . : . : . :
rJMSF044E08- CAAAGAAAATGGAACCTGGGAGCTCATTTCGATTTCTTCCCCTGCTTCTTCTTGATCACT
JMFF006P06+ CAAAGAAAATGGAACCTGGGAGCTCATTTCGATTTCTTCCCCTGCTTCTTCTTGATCACT
rJMSF039O14- CAAAGAAAATGGAACCTGGGAGCTCATTTCGATTTCTTCCCCTGCTTCTTCTTGATCACT
JMSF039O14+ CAAAGAAAATGGAACCTGGGAGCTCATTTCGATTTCTTCCCCTGCTTCTTCTTGATCACT
JMFN008L19+ CAAAGAAAATGGAACCTGGGAGCTCATTTCGATTTCTTCCCCTGCTTCTTCTTGATCACT
JMSF044E08+ CAAAGAAAATGGAACCTGGGAGCTCATTTCGATTTCTTCCCCTGCTTCTTCTTGATCACT
                      ____________________________________________________________
consensus CAAAGAAAATGGAACCTGGGAGCTCATTTCGATTTCTTCCCCTGCTTCTTCTTGATCACT
 
. : . : . : . : . : . :
rJMSF044E08- TCATCAATGTACATTATTCCTTTCCCTTTGTACACTTCAGGGGGCTTACAGCTTCTGATT
JMFF006P06+ TCATCAATGTACATTATTCCTTTCCCTTTGTACACTTCAGGGGGCTTACAGCTTCTGATT
rJMSF039O14- TCATCAATGTACATTATTCCTTTCCCTTTGTACACTTCAGGGGGCTTACAGCTTCTGATT
JMSF039O14+ TCATCAATGTACATTATTCCTTTCCCTTTGTACACTTCAGGGGGCTTACAGCTTCTGATT
JMFN008L19+ TCATCAATGTACATTATTCCTTTCCCTTTGTACACTTCAGGGGGCTTACAGCTTCTGATT
JMSF044E08+ TCATCAATGTACATTATTCCTTTCCCTTTGTACACTTCAGGGGGCTTACAGCTTCTGATT
                      ____________________________________________________________
consensus TCATCAATGTACATTATTCCTTTCCCTTTGTACACTTCAGGGGGCTTACAGCTTCTGATT
 
. : . : . : . : . : . :
rJMSF044E08- GATGCAGCAAACTGATGCGTTCGATGCTTGTCGATCCCAGTGCAGCAGATCACGTTGGGT
JMFF006P06+ GATGCAGCAAACTGATGCGTTCGATGCTTGTCGATCCCAGTGCAGCAGATCACGTTGGGT
rJMSF039O14- GATGCAGCAAACTGATGCGTTCGATGCTTGTCGATCCCAGTGCAGCAGATCACGTTGGGT
JMSF039O14+ GATGCAGCAAACTGATGCGTTCGATGCTTGTCGATCCCAGTGCAGCAGATCACGTTGGGT
JMFN008L19+ GATGCAGCAAACTGATGCGTTCGATGCTTGTCGATCCCAGTGCAGCAGATCACGTTGGGT
JMSF044E08+ GATGCAGCAAACTGATGCGTTCGATGCTTGTCGATCCCAGTGCAGCAGATCACGTTGGGT
                      ____________________________________________________________
consensus GATGCAGCAAACTGATGCGTTCGATGCTTGTCGATCCCAGTGCAGCAGATCACGTTGGGT
 
. : . : . : . : . : . :
rJMSF044E08- TTGAAGCAGAATACGCGAACTGCAGGAGGAACGGTCAGCTCAACCTCATGACTGTAACTC
JMFF006P06+ TTGAAGCAGAATACGCGAACTGCAGGAGGAACGGTCAGCTCAACCTCATGACTGTAACCC
rJMSF039O14- TTGAAGCAGAATACGCGAACTGCAGGAGGAACGGTCAGCTCAACCTCATGACTGTAACCC
JMSF039O14+ TTGAAGCAGAATACGCGAACTGCAGGAGGAACGGTCAGCTCAACCTCATGACTGTAACCC
JMFN008L19+ TTGAAGCAGAATACGCGAACTGCAGGAGGAACGGTCAGCTCAACCTCATGACTGTAACCC
JMSF044E08+ TTGAAGCAGAATACGCGAACTGCAGGAGGAACGGTCAGCTCAACCTCATGACTGTAACTC
                      ____________________________________________________________
consensus TTGAAGCAGAATACGCGAACTGCAGGAGGAACGGTCAGCTCAACCTCATGACTGTAACCC
 
. : . : . : . : . : . :
rJMSF044E08- AGTTTGAGGTACAACAAACGGCCCTCAGATTCTGCTCGTGCTTTGAAACCAACTCCAACA
JMFF006P06+ AGTTTGAGGTACAACAAACGGCCCTCAGATTCTGCTCGTGCTTTGAAACCAACTCCAACA
rJMSF039O14- AGTTTGAGGTACAACAAACGGCCCTCAGATTCTGCTCGTGCTTTGAAACCAACTCCAACA
JMSF039O14+ AGTTTGAGGTACAACAAACGGCCCTCAGATTCTGCTCGTGCTTTGAAACCAACTCCAACA
JMFN008L19+ AGTTTGAGGTACAACAAACGGCCCTCAGATTCTGCTCGTGCTTTGAAACCAACTCCAACA
JMSF044E08+ AGTTTGAGGTACAACAAACGGCCCTCAGATTCTGCTCGTGCTTTGAAACCAACTCCAACA
                      ____________________________________________________________
consensus AGTTTGAGGTACAACAAACGGCCCTCAGATTCTGCTCGTGCTTTGAAACCAACTCCAACA
 
. : . : . : . : . : . :
rJMSF044E08- ATCTTGAGAAAGCGAAAGAATTTAGCTTCCATTGCTACTGAGCAGCTTGCGACAGTGGAG
JMFF006P06+ ATCTTGAGAAAGCGAAAGAATTTAGCTTCCATTGCTACTGAGCAGCTTGCGACAGTGGAG
rJMSF039O14- ATCTTGAGAAAGCGAAAGAATTTAGCTTCCATTGCTACTGAGCAGCTTGCGACAGTGGAG
JMSF039O14+ ATCTTGAGAAAGCGAAAGAATTTAGCTTCCATTGCTACTGAGCAGCTTGCGACAGTGGAG
JMFN008L19+ ATCTTGAGAAAGCGAAAGAATTTAGCTTCCATTGCTACTGAGCAGCTTGCGACAGTGGAG
JMSF044E08+ ATCTTGAGAAAGCGAAAGAATTTAGCTTCCATTGCTACTGAGCAGCTTGCGACAGTGGAG
                      ____________________________________________________________
consensus ATCTTGAGAAAGCGAAAGAATTTAGCTTCCATTGCTACTGAGCAGCTTGCGACAGTGGAG
 
. : . : . : . : . : . :
rJMSF044E08- AGGCCTGAGGCAGAAGACGGTGGGCGGCGGTGACTGGCGAGGAAGAGGCGCCGTGTGGTG
JMFF006P06+ AGGCCTGAGGCAGAAGACGGTGGGCGGCGGTGACTGGCGAGGAAGAGGCGCCGTGTGGTG
rJMSF039O14- AGGCCTGAGGCAGAAGACGGTGGGCGGCGGTGACTGGCGAGGAAGAGGCGCCGTGTGGTG
JMSF039O14+ AGGCCTGAGGCAGAAGACGGTGGGCGGCGGTGACTGGCGAGGAAGAGGCGCCGTGTGGTG
JMFN008L19+ AGGCCTGAGGCAGAAGACGGTGGGCGGCGGTGACTGGCGAGGAAGAGGCGCCGTGTGGTG
JMSF044E08+ AGGCCTGAGGCAGAAGACGGTGGGCGGCGGTGACTGGCGAGGAAGAGGCGCCGTGTGGTG
                      ____________________________________________________________
consensus AGGCCTGAGGCAGAAGACGGTGGGCGGCGGTGACTGGCGAGGAAGAGGCGCCGTGTGGTG
 
. : . : . : . : . : . :
rJMSF044E08- GCGGGCCGCGAGCGTTGGGCGGTGGCGAGAGCAGAGAACGTTTTGGCGAGGGAGGC
JMFF006P06+ GCGGGCCGCGAGCGTTGGGCGGTGGCGAGAGCAGAGAACGTTTTGGCGAGGGAGGC
rJMSF039O14- GCGGGCCGCGAGCGTTGGGCGGTGGCGAGAGCAGAGAACGTTTTGGCGAGGGAGGC
JMSF039O14+ GCGGGCCGCGAGCGTTGGGCGGTGGCGAGAGCAGAGAACGTTTTGGCGAGGGAGGC
JMFN008L19+ GCGGGCCGCGA
JMSF044E08+ GCGGGCCGCGAGCGTTGGGCGGTGGCGAGAGCAGAGAACGTTTTGGCGAGGGAGGCGCCC
                      ____________________________________________________________
consensus GCGGGCCGCGAGCGTTGGGCGGTGGCGAGAGCAGAGAACGTTTTGGCGAGGGAGGCGCCC