Previous Contig 007597:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011J17Sequence413007597 (3)gb:AK175518_18175064e-21Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-93-O16.
JMSF034P07Sequence621007597 (3)gb:AK175518_18175062e-54Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-93-O16.
JMSF044C24Sequence704007597 (3)gb:AK175518_18175062e-57Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-93-O16.825024080gb:AP004090_18375603e-84Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ13

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034P07+ CTCAACAGCA
JMSF044C24+ GGGGAAGAATTCTGGAGGTAGTATTTGATCCACCCTCAACAGCA
                      ____________________________________________________________
consensus GGGGAAGAATTCTGGAGGTAGTATTTGATCCACCCTCAACAGCA
 
. : . : . : . : . : . :
JMSF034P07+ TGTTCAAGAGCTTCCCATTCTTCCAGATTGGGAACATTGGAGCCCCACCCAGGCATGTCC
JMSF044C24+ TGTTCAAGAGCTTCCCATTCTTCCAGATTGGGAACATTGGAGCCCCACCCAGGCATGTCC
                      ____________________________________________________________
consensus TGTTCAAGAGCTTCCCATTCTTCCAGATTGGGAACATTGGAGCCCCACCCAGGCATGTCC
 
. : . : . : . : . : . :
JMSF034P07+ TTTTCAGGCAGCCTTCTCACATTGACTGTGTGGATTGGTGGTGGGCAATCCCTAAGGTGC
JMSF044C24+ TTTTCAGGCAGCCTTCTCACATTGACTGTGTGGATTGGTGGTGGGCAATCCCTAAGGTGC
                      ____________________________________________________________
consensus TTTTCAGGCAGCCTTCTCACATTGACTGTGTGGATTGGTGGTGGGCAATCCCTAAGGTGC
 
. : . : . : . : . : . :
JMSF034P07+ TCGGTTCCATGAATTTGAGACTCCAACATGTAAGTCAAAGCAATGAGCTTCAGATCTACA
JMSF044C24+ TCGGTTCCATGAATTTGAGACTCCAACATGTAAGTCAAAGCAATGAGCTTCAGATCTACA
                      ____________________________________________________________
consensus TCGGTTCCATGAATTTGAGACTCCAACATGTAAGTCAAAGCAATGAGCTTCAGATCTACA
 
. : . : . : . : . : . :
JMSF034P07+ TCTGACAGTGTCTGCAAATCTCCAGTTGCCCTTGCAAAGTTAATAACTCTTTTGAGAGCA
JMSF011J17+ TCTCCAGTTGCCCTTGCAAAGTTAATAACTCTTTTGAGAGCA
JMSF044C24+ TCTGACAGTGTCTGCAAATCTCCAGTTGCCCTTGCAAAGTTAATAACTCTTTTGAGAGCA
                      ____________________________________________________________
consensus TCTGACAGTGTCTGCAAATCTCCAGTTGCCCTTGCAAAGTTAATAACTCTTTTGAGAGCA
 
. : . : . : . : . : . :
JMSF034P07+ TCAGGCGAGGGTTCCATGGTGTCCACAGTGAAAGGAAGGAAATGGAGGGAGTGGCGAGAG
JMSF011J17+ TCAGGCGAGGGTTCCATGGTGTCCACAGTGAAAGGAAGGAAATGGAGGGAGTGGCGAGAG
JMSF044C24+ TCAGGCGAGGGTTCCATGGTGTCCACAGTGAAAGGAAGGAAATGGAGGGAGTGGCGAGAG
                      ____________________________________________________________
consensus TCAGGCGAGGGTTCCATGGTGTCCACAGTGAAAGGAAGGAAATGGAGGGAGTGGCGAGAG
 
. : . : . : . : . : . :
JMSF034P07+ GTAGGATCCCGGATTTCGCTCAAGACCTCCGGGACAGACACGAAGCGGTCGGCGTTATGC
JMSF011J17+ GTAGGATCCCGGATTTCGCTCAAGACCTCCGGGACAGACACGAAGCGGTCGGCGTTATGC
JMSF044C24+ GTAGGATCCCGGATTTCGCTCAAGACCTCCGGGACAGACACGAAGCGGTCGGCGTTATGC
                      ____________________________________________________________
consensus GTAGGATCCCGGATTTCGCTCAAGACCTCCGGGACAGACACGAAGCGGTCGGCGTTATGC
 
. : . : . : . : . : . :
JMSF034P07+ GACAGATTCTGACCACCCTGGATGATAGCGTTGGCATCCACTACCGCCACCGCTATTCCC
JMSF011J17+ GACAGATTCTGACCACCCTGGATGATAGCGTTGGCATCCACTACCGCCACCGCTATTCCC
JMSF044C24+ GACAGATTCTGACCACCCTGGATGATAGCGTTGGCATCCACTACCGCCACCGCTATTCCC
                      ____________________________________________________________
consensus GACAGATTCTGACCACCCTGGATGATAGCGTTGGCATCCACTACCGCCACCGCTATTCCC
 
. : . : . : . : . : . :
JMSF034P07+ TTAGTCGAATTGCAACTCCCCACCAACTCCCGATTGGGAGGCGGAGGTGCCGCGGCGGCG
JMSF011J17+ TTAGTCGAATTGCAACTCCCCACCAACTCCCGATTGGGAGGCGGAGGTGCCGCGGCGGCG
JMSF044C24+ TTAGTCGAATTGCAACTCCCCACCAACTCCCGATTGGGAGGCGGAGGTGCCGCGGCGGCG
                      ____________________________________________________________
consensus TTAGTCGAATTGCAACTCCCCACCAACTCCCGATTGGGAGGCGGAGGTGCCGCGGCGGCG
 
. : . : . : . : . : . :
JMSF034P07+ AAAGGGGATTGGTGGTTCTGTTGCGGCGGTGGCGGCAGTTGCTGCTTCACGATGTTGCTC
JMSF011J17+ AAAGGGGATTGGTGGTTCTGTTGCGGCGGTGGCGGCAGTTGCTGCTTCACGATGTTGCTC
JMSF044C24+ AAAGGGGATTGGTGGTTCTGTTGCGGCGGTGGCGGCAGTTGCTGCTTCACGATGTTGCTC
                      ____________________________________________________________
consensus AAAGGGGATTGGTGGTTCTGTTGCGGCGGTGGCGGCAGTTGCTGCTTCACGATGTTGCTC
 
. : . : . : . : . : . :
JMSF034P07+ CAACATTGCGGTGGAGGCTGAGATGTGGGCTGGACCTCCATGGTTGGGAGATTGTGAGAG
JMSF011J17+ CAACATTGCGGTGGAGGCTGAGATGTGGGCTGGACCTCCATGGTTGGGAGATTGTGAGAG
JMSF044C24+ CAACATTGCGGTGGAGGCTGAGATGTGGGCTGGACCTCCATGGTTGGGAGATTGTGAGAG
                      ____________________________________________________________
consensus CAACATTGCGGTGGAGGCTGAGATGTGGGCTGGACCTCCATGGTTGGGAGATTGTGAGAG
 
. : . : . : . : . : . :
JMSF034P07+ TGGCGAAGCT
JMSF011J17+ TGGCGAAGCT
JMSF044C24+ TGGCGAAGCTGTTGAACTTTGCGGAGTACTTTAGGGCTAAAACCCTAGTTACAACTTACC
                      ____________________________________________________________
consensus TGGCGAAGCTGTTGAACTTTGCGGAGTACTTTAGGGCTAAAACCCTAGTTACAACTTACC