Previous Contig 007592:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF044B08Sequence605007592 (2)gb:AP004846_18458841e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12560007592 (2)gb:AP004846_18458848e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044B08+ GGTCTG
JMSF044B08- GGTCTG
                      ____________________________________________________________
consensus GGTCTG
 
. : . : . : . : . : . :
rJMSF044B08+ GTTTATGATACCGGAATTGATGATTATGTGGATTTTTTATGTACCATTGGGTATGATAGC
JMSF044B08- GTTTATGATACCGGAATTGATGATTATGTGGATTTTTTATGTACCATTGGGTATGATAGC
                      ____________________________________________________________
consensus GTTTATGATACCGGAATTGATGATTATGTGGATTTTTTATGTACCATTGGGTATGATAGC
 
. : . : . : . : . : . :
rJMSF044B08+ CAGACAATTGCGTTGTTCCTGCGGGATGGTCCTCCGGTGGATTGCAGCACGCGAAATTTG
JMSF044B08- CAGACAATTGCGTTGTTCCTGCGGGATGGTCCTCCGGTGGATTGCAGCACGCGAAATTTG
                      ____________________________________________________________
consensus CAGACAATTGCGTTGTTCCTGCGGGATGGTCCTCCGGTGGATTGCAGCACGCGAAATTTG
 
. : . : . : . : . : . :
rJMSF044B08+ GGTAACCCCGGCTCTCTAAATTACCCTTCGTTTTCGGTTGTTTTAAAAAATAATCTCCTG
JMSF044B08- GGTAACCCCGGCTCTCTAAATTACCCTTCGTTTTCGGTTGTTTTAAAAAATAATCTCCTG
                      ____________________________________________________________
consensus GGTAACCCCGGCTCTCTAAATTACCCTTCGTTTTCGGTTGTTTTAAAAAATAATCTCCTG
 
. : . : . : . : . : . :
rJMSF044B08+ ACGGTAAAGTACAAGAGAACCGTTAAAAATGTGGGAACGGTCAAAAATGTTGTTTATGTG
JMSF044B08- ACGGTAAAGTACAAGAGAACCGTTAAAAATGTGGGAACGGTCAAAAATGTTGTTTATGTG
                      ____________________________________________________________
consensus ACGGTAAAGTACAAGAGAACCGTTAAAAATGTGGGAACGGTCAAAAATGTTGTTTATGTG
 
. : . : . : . : . : . :
rJMSF044B08+ GCACAAGGGAATATTTCTCCCCGAAATGCGGTGAATGTGAATGTGTCACCAAATAGGTTG
JMSF044B08- GCACAAGGGAATATTTCTCCCCGAAATGCGGTGAATGTGAATGTGTCACCAAATAGGTTG
                      ____________________________________________________________
consensus GCACAAGGGAATATTTCTCCCCGAAATGCGGTGAATGTGAATGTGTCACCAAATAGGTTG
 
. : . : . : . : . : . :
rJMSF044B08+ GAGTTTAGTGAAGGAAACGATATATTATCTTATGAGGTGACTTTTACAAGCGCTACACCA
JMSF044B08- GAGTTTAGTGAAGGAAACGATATATTATCTTATGAGGTGACTTTTACAAGCGCTACACCA
                      ____________________________________________________________
consensus GAGTTTAGTGAAGGAAACGATATATTATCTTATGAGGTGACTTTTACAAGCGCTACACCA
 
. : . : . : . : . : . :
rJMSF044B08+ ACTGATGCGGGGGCATACGGGTCATTAGTCTGGAGCGATGGGACACACATTGTTAGTAGC
JMSF044B08- ACTGATGCGGGGGCATACGGGTCATTAGTCTGGAGCGATGGGACACACATTGTTAGTAGC
                      ____________________________________________________________
consensus ACTGATGCGGGGGCATACGGGTCATTAGTCTGGAGCGATGGGACACACATTGTTAGTAGC
 
. : . : . : . : . : . :
rJMSF044B08+ CCAATAGCTGTGATGTGGCAAGGTGCCGCTTTGAAGTCTGAACTCTAAATGTATGGATGA
JMSF044B08- CCAATAGCTGTGATGTGGCAAGGTGCCGCTTTGAAGTCTGAACTCTAAATGTATGGATGA
                      ____________________________________________________________
consensus CCAATAGCTGTGATGTGGCAAGGTGCCGCTTTGAAGTCTGAACTCTAAATGTATGGATGA
 
. : . : . : . : . : . :
rJMSF044B08+ ATGTGCCTAGTTTGTTCCTANCGTAGCCCATGTAATAAAATAAATTATTATTATAGTGGA
JMSF044B08- ATGTGCCTAGTTTGTTCCTA-CGTAGCCCATGTAATAAAATAAATTATTATTATAGTGGA
                      ____________________________________________________________
consensus ATGTGCCTAGTTTGTTCCTANCGTAGCCCATGTAATAAAATAAATTATTATTATAGTGGA
 
. : . : . : . : . : . :
rJMSF044B08+ TATATCCACAAATA
JMSF044B08- TATATCCACAAATATATGTATGCAATAATATAATGGGCTTAGTTCCTTTCAAAAAAAAAA
                      ____________________________________________________________
consensus TATATCCACAAATATATGTATGCAATAATATAATGGGCTTAGTTCCTTTCAAAAAAAAAA