Previous Contig 007591:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022B21Sequence520007591 (9)gb:AF458962_18016181e-36Zea mays CDC5 protein (CDC5) mRNA, complete cds.793002726 (5)pir|T30290|T302900.008AAS surface protein - Staphylococcus saprophyticus>gb:SSAASPROT_190478 Staphyloc
JMFS085F01Sequence559007591 (9)gb:AF458962_18016188e-49Zea mays CDC5 protein (CDC5) mRNA, complete cds.
JMFS112H09Sequence626007591 (9)gb:AF458962_18016181e-63Zea mays CDC5 protein (CDC5) mRNA, complete cds.
JMFS121H08Sequence568007591 (9)gb:AF458962_18016182e-87Zea mays CDC5 protein (CDC5) mRNA, complete cds.
JMFS125H07Sequence568007591 (9)gb:AF458962_18016181e-52Zea mays CDC5 protein (CDC5) mRNA, complete cds.
JMFS131A11Sequence608007591 (9)gb:AF458962_18016189e-66Zea mays CDC5 protein (CDC5) mRNA, complete cds.
JMFS137A04Sequence597007591 (9)gb:AF458962_18016185e-63Zea mays CDC5 protein (CDC5) mRNA, complete cds.
JMSF002K18Sequence400007591 (9)gb:AF458962_18016185e-14Zea mays CDC5 protein (CDC5) mRNA, complete cds.732002726 (5)pir|T30290|T302901e-05AAS surface protein - Staphylococcus saprophyticus>gb:SSAASPROT_190478 Staphyloc
JMSF044B01Sequence742007591 (9)gb:AF458962_18016181e-81Zea mays CDC5 protein (CDC5) mRNA, complete cds.813002726 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS121H08+ GCGTGCTTCAGAAAGCATCTCTTTCTCATCCTCATCCATATCAACAGGAT
JMSF044B01+ TCCTCATCCATATCAACAGGAT
                      ____________________________________________________________
consensus GCGTGCTTCAGAAAGCATCTCTTTCTCATCCTCATCCATATCAACAGGAT
 
. : . : . : . : . : . :
JMFS121H08+ CAGGACGAGCAGGCTTTGATTCTGGATTTGGATCAATCTCTCCTGGCCTCAGTTTCCTTG
JMFS131A11+ TTCCTTG
JMSF044B01+ CAGGACGAGCAGGCTTTGATTCTGGATTTGGATCAATCTCTCCTGGCCTCAGTTTCCTTG
                      ____________________________________________________________
consensus CAGGACGAGCAGGCTTTGATTCTGGATTTGGATCAATCTCTCCTGGCCTCAGTTTCCTTG
 
. : . : . : . : . : . :
JMFS121H08+ GATCATCACCTGCTTCATAATTCTCATCCTTGGCACATGCTGCATCAAGGAGCTTCTCAT
JMFS137A04+ TGCTTCATAATTCTCATCCTTGGCACATGCTGCATCAAGGAGCTTCTCAT
JMFS085F01+ CTCAT
JMFS112H09+ TCATCACCTGCTTCATAATTCTCATCCTTGGCACATGCTGCATCAAGGAGCTTCTCAT
JMFS131A11+ GATCATCACCTGCTTCATAATTCTCATCCTTGGCACATGCTGCATCAAGGAGCTTCTCAT
JMSF044B01+ GATCATCACCTGCTTCATAATTCTCATCCTTGGCACATGCTGCATCAAGGAGCTTCTCAT
                      ____________________________________________________________
consensus GATCATCACCTGCTTCATAATTCTCATCCTTGGCACATGCTGCATCAAGGAGCTTCTCAT
 
. : . : . : . : . : . :
JMFS121H08+ AGCGTTCCAGGCACTGTGATGGCGTACGGCCCACAATAGGTGCAATGGTTCTCCACTGTG
JMFS137A04+ AGCGTTCCAGGCACTGTGATGGCGTACGGCCCACAATAGGTGCAATGGTTCTCCACTGTG
JMFS125H07+ AGCGTTCCAGGCACTGTGATGGCGTACGGCCCACAATAGGTGCAATGGTTCTCCACTGTG
JMFS085F01+ AGCGTTCCAGGCACTGTGATGGCGTACGGCCCACAATAGGTGCAATGGTTCTCCACTGTG
JMFS112H09+ AGCGTTCCAGGCACTGTGATGGCGTACGGCCCACAATAGGTGCAATGGTTCTCCACTGTG
JMFS131A11+ AGCGTTCCAGGCACTGTGATGGCGTACGGCCCACAATAGGTGCAATGGTTCTCCACTGTG
JMSF044B01+ AGCGTTCCAGGCACTGTGATGGCGTACGGCCCACAATAGGTGCAATGGTTCTCCACTGTG
                      ____________________________________________________________
consensus AGCGTTCCAGGCACTGTGATGGCGTACGGCCCACAATAGGTGCAATGGTTCTCCACTGTG
 
. : . : . : . : . : . :
JMFS121H08+ TGGGCATAAGCTTTGCAAGGTGAAGCAGCTTCTCATCTTCTTCTCTAGTCCACTCAGTCT
JMFS137A04+ TGGGCATAAGCTTTGCAAGGTGAAGCAGCTTCTCATCTTCTTCTCTAGTCCACTCAGTCT
JMFS125H07+ TGGGCATAAGCTTTGCAAGGTGAAGCAGCTTCTCATCTTCTTCTCTAGTCCACTCAGTCT
JMFS085F01+ TGGGCATAAGCTTGNCAAGGTGAAGCAGCTTCTCATCTTCTTCTCTAGTCCACTCAGTCT
JMFS112H09+ TGGGCATAAGCTTTGCAAGGTGAAGCAGCTTCTCATCTTCTTCTCTAGTCCACTCAGTCT
JMFS131A11+ TGGGCATAAGCTTTGCAAGGTGAAGCAGCTTCTCATCTTCTTCTCTAGTCCACTCAGTCT
JMFF022B21+ GGTGAAGCAGCTTCTCATCTTCTTCTCTAGTCCACTCAGTCT
JMSF044B01+ TGGGCATAAGCTTTGCAAGGTGAAGCAGCTTCTCATCTTCTTCTCTAGTCCACTCAGTCT
                      ____________________________________________________________
consensus TGGGCATAAGCTTTGCAAGGTGAAGCAGCTTCTCATCTTCTTCTCTAGTCCACTCAGTCT
 
. : . : . : . : . : . :
JMFS121H08+ TTTTGATGGAAGGGTCGAGCCACTCATACCAACGAGCTTTGCACTGCTTGGCAGATTTAC
JMFS137A04+ TTTTGATGGAAGGGTCGAGCCACTCATACCAACGAGCTTTGCACTGCTTGGCAGATTTAC
JMFS125H07+ TTTTGATGGAAGGGTCGAGCCACTCATACCAACGAGCTTTGCACTGCTTGGCAGATTTAC
JMFS085F01+ TTTTGATGGAAGGGTCGAGCCACTCATACCANCGAGCTTTGCACTGCTTGGCAGATTTAC
JMFS112H09+ TTTTGATGGAAGGGTCGAGCCACTCATACCAACGAGCTTTGCACTGCTTGGCAGATTTAC
JMFS131A11+ TTTTGATGGAAGGGTCGAGCCACTCATACCAACGAGCTTTGCACTGCTTGGCAGATTTAC
JMFF022B21+ TTTTGATGGAAGGGTCGAGCCACTCATACCAACGAGCTTTGCACTGCTTGGCAGATTTAC
JMSF044B01+ TTTTGATGGAAGGGTCGAGCCACTCATACCAACGAGCTTTGCACTGCTTGGCAGATTTAC
                      ____________________________________________________________
consensus TTTTGATGGAAGGGTCGAGCCACTCATACCAACGAGCTTTGCACTGCTTGGCAGATTTAC
 
. : . : . : . : . : . :
JMFS121H08+ GAACAAGAAGGGAGGAGATACGGGCCCACTGGTTCTTGCCATACTTCATGACCGCTGCCT
JMFS137A04+ GAACAAGAAGGGAGGAGATACGGGCCCACTGGTTCTTGCCATACTTCATGACCGCTGCCT
JMFS125H07+ GAACAAGAAGGGAGGAGATACGGGCCCACTGGTTCTTGCCATACTTCATGACCGCTGCCT
JMFS085F01+ GAACAAGAAGGGAGGAGATACGGGCCCACTGGTTCTTGCCATACTTCATGACCGCTGCCT
JMFS112H09+ GAACAAGAAGGGAGGAGATACGGGCCCACTGGTTCTTGCCATACTTCATGACCGCTGCCT
JMFS131A11+ GAACAAGAAGGGAGGAGATACGGGCCCACTGGTTCTTGCCATACTTCATGACCGCTGCCT
JMSF002K18+ ACAAGAAGGGAGGAGATACGGGCCCACTGGTTCTTGCCATACTTCATGACCGCTGCCT
JMFF022B21+ GAACAAGAAGGGAGGAGATACGGGCCCACTGGTTCTTGCCATACTTCATGACCGCTGCCT
JMSF044B01+ GAACAAGAAGGGAGGAGATACGGGCCCACTGGTTCTTGCCATACTTCATGACCGCTGCCT
                      ____________________________________________________________
consensus GAACAAGAAGGGAGGAGATACGGGCCCACTGGTTCTTGCCATACTTCATGACCGCTGCCT
 
. : . : . : . : . : . :
JMFS121H08+ TCAGGATCTCGTCCTCCGTGTTCTTCCATACTCCTCCCTTTATCATAATCCTCATCTTCG
JMFS137A04+ TCAGGATCTCGTCCTCCGTGTTCTTCCATACTCCTCCCTTTATCATAATCCTCATCTTCG
JMFS125H07+ TCAGGATCTCGTCCTCCGTGTTCTTCCATACTCCTCCCTTTATCATAATCCTCATCTTCG
JMFS085F01+ TCAGGATCTCGTCCTCCGTGTTCTTCCATACTCCTCCCTTTATCATAATCCTCATCTTCG
JMFS112H09+ TCAGGATCTCGTCCTCCGTGTTCTTCCATACTCCTCCCTTTATCATAATCCTCATCTTCG
JMFS131A11+ TCAGGATCTCGTCCTCCGTGTTCTTCCATACTCCTCCCTTTATCATAATCCTCATCTTCG
JMSF002K18+ TCAGGATCTCGTCCTCCGTGTTCTTCCATACTCCTCCCTTTATCATAATCCTCATCTTCG
JMFF022B21+ TCAGGATCTCGTCCTCCGTGTTCTTCCATACTCCTCCCTTTATCATAATCCTCATCTTCG
JMSF044B01+ TCAGGATCTCGTCCTCCGTGTTCTTCCATACTCCTCCCTTTATCATAATCCTCATCTTTG
                      ____________________________________________________________
consensus TCAGGATCTCGTCCTCCGTGTTCTTCCATACTCCTCCCTTTATCATAATCCTCATCTTCG
 
. : . : . : . : . : . :
JMFS121H08+ CTCACTGTTTCTACCTCCCGGAGGAGGACCTTCGCTTCTCCTGAATAATAACTTACTAAA
JMFS137A04+ CTCACTGTTTCTACCTCCCGGAGGAGGACCTTCGCTTCTCCTGAATAATAACTTACTAAA
JMFS125H07+ CTCACTGTTTCTACCTCCCGGAGGAGGACCTTCGCTTCTCCTGAATAATAACTTACTAAA
JMFS085F01+ CTCACTGTTTCTACCTCCCGGAGGAGGACCTTCGCTTCTCCTGAATAATAACTTACTAAA
JMFS112H09+ CTCACTGTTTCTACCTCCCGGAGGAGGACCTTCGCTTCTCCTGAATAATAACTTACTAAA
JMFS131A11+ CTCACTGTTTCTACCTCCCGGAGGAGGACCTTCGCTTCTCCTGAATAATAACTTACTAAA
JMSF002K18+ CTCACTGTTTCTACCTCCCGGAGGAGGACCTTCGCTTCTCCTGAATAATAACTTACTAAA
JMFF022B21+ CTCACTGTTTCTACCTCCCGGAGGAGGACCTTCGCTTCTCCTGAATAATAACTTACTAAA
JMSF044B01+ CTCACTGTTTCTACCTCCCGGAGGAGGACCTTCGCTTCTCCTGAATAATAACTTACTAAA
                      ____________________________________________________________
consensus CTCACTGTTTCTACCTCCCGGAGGAGGACCTTCGCTTCTCCTGAATAATAACTTACTAAA
 
. : . : . : . : . : . :
JMFS121H08+ ACTCGAACCACCGATGTACCGGCGGTGCTAGGGTTTGC
JMFS137A04+ ACTCGAACCACCGATGTACCGGCGGTGCTAGGGTTTGCAAACCCCGCGATAACTGAGACG
JMFS125H07+ ACTCGAACCACCGATGTACCGGCGGTGCTAGGGTTTGCAAACCCCGCGATAACTGAGACG
JMFS085F01+ ACTCGAACCACCGATGTACCGGCGGTGCTAGGGTTTGCAAACCCCGCGATAACTGAGACG
JMFS112H09+ ACTCGAACCACCGATGTACCGGCGGTGCTAGGGTTTGCAAACCCCGCGATAACTGAGACG
JMFS131A11+ ACTCGAACCACCGATGTACCGGCGGTGCTAGGGTTTGCAAACCCCGCGATAACTGAGACG
JMSF002K18+ ACTCGAACCACCGATGTACCGGCGGTGCTAGGGTTTGCAAACCCCGCGATAACTGAGACG
JMFF022B21+ ACTCGAACCACCGATGTACCGGCGGTGCTAGGGTTTGCAAACCCCGCGATAACTGAGACG
JMSF044B01+ ACTCGAACCACCGATGTACCGACGGTGCTAGGGTTTGCAAACCCCGCGATAACTGAGACG
                      ____________________________________________________________
consensus ACTCGAACCACCGATGTACCGGCGGTGCTAGGGTTTGCAAACCCCGCGATAACTGAGACG
 
. : . : . : . : . : . :
JMFS137A04+ AAAACCGCTCCGCCTCCCTAGATATCGACGTTCATATGCATACTGTGAACGTATACGCTT
JMFS125H07+ AAAACCGCTCCGCCTCCCTAGATATCGACGTTCATATGCATACTGTGAACGTATACGCTT
JMFS085F01+ AAAACCGCTCCGCCTCCCTAGATATCGACGTTCATATGCATACTGTGAACGTATACGCTT
JMFS112H09+ AAAACCGCTCCGCCTCCCTAGATATCGACGTTCATATGCATACTGTGAACGTATACGCTT
JMFS131A11+ AAAACCGCTCCGCCTCCCTAGATATCGACGTTCATATGCATACTGTGAACGTATACGCTT
JMSF002K18+ AAAACCGCTCCGCCTCCCTAGATATCGACGTTCATATGCATACTGTGAACGTATACGCTT
JMFF022B21+ AAAACCGCTCCGCCTCCCTAGATATCGACGTTCATATGCATACTGTGAACGTATACGCTT
JMSF044B01+ AAAACCGCTCCGCCTCCCTAGATATCGACGTTCATATGCATACTGTGAACGTATACGCTT
                      ____________________________________________________________
consensus AAAACCGCTCCGCCTCCCTAGATATCGACGTTCATATGCATACTGTGAACGTATACGCTT
 
. : . : . : . : . : . :
JMFS137A04+ GGCGTTTCCTCTGTGTCGCAGTTTTCGTGTGTAGATTTGGATGATAATGGCTGTGAAACC
JMFS125H07+ GGCGTTTCCTCTGTGTCGCAGTTTTCGTGTGTAGATTTGGATGATAATGGCTGTGAAACC
JMFS085F01+ GGCGTTTCCTCTGTGTCGCAGTTTTCGTGTGTAGATTTGGATGATAATGGCTGT-AAACC
JMFS112H09+ GGCGTTTCCTCTGTGTCGCAGTTTTCGTGTGTAGATTTGGATGATAATGGCTGTGAAACC
JMFS131A11+ GGCGTTTCCTCTGTGTCGCAGTTTTCGTGTGTAGATTTGGATGATAATGGCTGTGAAA
JMSF002K18+ GGCGTTTCCTCTGTGTCGCAGTTTTCGTGTGTAGATTTGGATGATAATGGCTGTGAAACC
JMFF022B21+ GGCGTTTCCTCTGTGTCGCAGTTTTCGTGTGTAGATTTGGATGATAATGGCTGTGAAACC
JMSF044B01+ GGCGTTTCCTCTGTGTCGCAGTTTTCGTGTGTAGATTTGGATGATAATGGCTGTGAAACC
                      ____________________________________________________________
consensus GGCGTTTCCTCTGTGTCGCAGTTTTCGTGTGTAGATTTGGATGATAATGGCTGTGAAACC
 
. : . : . : . : . : . :
JMFS137A04+ ATGAATC
JMFS125H07+ ATGAATCGCTTCAGTCCCCTGAATCTGA
JMFS085F01+ AT-AATCGCTTCAGTC
JMFS112H09+ ATGAATCGCTTCAGTCCCCTGAATCTGA
JMSF002K18+ ATGAATCGCTTCAGTCCCCTGAATCTGAGCAGAGCTCCCTT
JMFF022B21+ ATGAATCGCTTCAGTCCCCTGAATCTGAGCAGAGCTCCCTTAGCTATTTGTTGCAT
JMSF044B01+ ATGAATCGCTTCAGTCCCCTGAATCTGAGCAGAGCTCCCTTAGCTATTTGTTGCATGCCC
                      ____________________________________________________________
consensus ATGAATCGCTTCAGTCCCCTGAATCTGAGCAGAGCTCCCTTAGCTATTTGTTGCATGCCC