Previous Contig 007583:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF031E21Sequence603007583 (2)sp|O24145|4CL1_TOBAC1e-664-coumarate--CoA ligase 1 (EC 6.2.1.12) (4CL 1) (4-coumaroyl-CoA synthase 1).>gb682012775 (2)sp|O24145|4CL1_TOBAC3e-684-coumarate--CoA ligase 1 (EC 6.2.1.12) (4CL 1) (4-coumaroyl-CoA synthase 1).>gb
JMSF043O24Sequence622007583 (2)sp|O24145|4CL1_TOBAC4e-684-coumarate--CoA ligase 1 (EC 6.2.1.12) (4CL 1) (4-coumaroyl-CoA synthase 1).>gb680012775 (2)sp|O24145|4CL1_TOBAC3e-924-coumarate--CoA ligase 1 (EC 6.2.1.12) (4CL 1) (4-coumaroyl-CoA synthase 1).>gb

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF031E21+ CGAGAAGTGC
JMSF043O24+ CTCCGATAGCTCCGAGAAGTGC
                      ____________________________________________________________
consensus CTCCGATAGCTCCGAGAAGTGC
 
. : . : . : . : . : . :
JMSF031E21+ GAGCAACCTTTGGGAGCCGAGTCGGTGCAGAAAACCTTGATTTCATTCTCCCATGCATAT
JMSF043O24+ GAGCAACCTTTGGGAGCCGAGTCGGTGCAGAAAACCTTGATTTCATTCTCCCATGCATAT
                      ____________________________________________________________
consensus GAGCAACCTTTGGGAGCCGAGTCGGTGCAGAAAACCTTGATTTCATTCTCCCATGCATAT
 
. : . : . : . : . : . :
JMSF031E21+ TCTCTGACCTTGTCCACGTAACAAGCTAGAGTCACGATGAGCTTTGCATTGGACGCCTTG
JMSF043O24+ TCTCTGACCTTGTCCACGTAACAAGCTAGAGTCACGATGAGCTTTGCATTGGACGCCTTG
                      ____________________________________________________________
consensus TCTCTGACCTTGTCCACGTAACAAGCTAGAGTCACGATGAGCTTTGCATTGGACGCCTTG
 
. : . : . : . : . : . :
JMSF031E21+ ACCTGCTTAATCACCTCCGCCGGCGTGAACAGAGGATTCGCCATCGTCGCCACAGCGCCG
JMSF043O24+ ACCTGCTTAATCACCTCCGCCGGCGTGAACAGAGGATTCGCCATCGTCGCCACAGCGCCG
                      ____________________________________________________________
consensus ACCTGCTTAATCACCTCCGCCGGCGTGAACAGAGGATTCGCCATCGTCGCCACAGCGCCG
 
. : . : . : . : . : . :
JMSF031E21+ CGGTAAGACGCGCCGAGGAACGCGAACACAAACTCCGGACAGTTGGGAAGCAGGATCATG
JMSF043O24+ CGGTAAGACGCGCCGAGGAACGCGAACACAAACTCCGGACAGTTGGGAAGCAGGATCATG
                      ____________________________________________________________
consensus CGGTAAGACGCGCCGAGGAACGCGAACACAAACTCCGGACAGTTGGGAAGCAGGATCATG
 
. : . : . : . : . : . :
JMSF031E21+ ATGGTGTCGCCGTGGTTGATCCCTGCTTTATGAAGCCCGGCCGCAACTTTCCGGCAACTG
JMSF043O24+ ATGGTGTCGCCGTGGTTGATCCCTGCTTTATGAAGCCCGGCCGCAACTTTCCGGCAACTG
                      ____________________________________________________________
consensus ATGGTGTCGCCGTGGTTGATCCCTGCTTTATGAAGCCCGGCCGCAACTTTCCGGCAACTG
 
. : . : . : . : . : . :
JMSF031E21+ AGTTCCACTTCAGCGTAAGTATATACCCGATCATCGGAGCCGTTGATGAGGCAGGGGCGG
JMSF043O24+ AGTTCCACTTCAGCGTAAGTATATACCCGATCATCGGAGCCGTTGATGAGGCAGGGGCGG
                      ____________________________________________________________
consensus AGTTCCACTTCAGCGTAAGTATATACCCGATCATCGGAGCCGTTGATGAGGCAGGGGCGG
 
. : . : . : . : . : . :
JMSF031E21+ TCCCGTAAGACGGAAATGTTCTGGAAGCAATAGGAATGGAGAGGGAGGTGGTTGGAGATG
JMSF043O24+ TCCCGTAAGACGGAAATGTTCTGGAAGCAATAGGAATGGAGAGGGAGGTGGTTGGAGATG
                      ____________________________________________________________
consensus TCCCGTAAGACGGAAATGTTCTGGAAGCAATAGGAATGGAGAGGGAGGTGGTTGGAGATG
 
. : . : . : . : . : . :
JMSF031E21+ TAAATATCGGGGAGTTTTGATCGGAAAATGATGTCACCACCGCCCTGCTCTGTTTTGGTT
JMSF043O24+ TAAATATCGGGGAGTTTTGATCGGAAAATGATGTCACCACCGCCCTGCTCTGTTTTGGTT
                      ____________________________________________________________
consensus TAAATATCGGGGAGTTTTGATCGGAAAATGATGTCACCACCGCCCTGCTCTGTTTTGGTT
 
. : . : . : . : . : . :
JMSF031E21+ GCCATCTTCAATGGAGTTGGTGGGAGAGGGAAGAAATGGACACACCAAATAAAAATTT-A
JMSF043O24+ GCCATCTTCAATGGAGTTGGTGGGAGAGGGAAGAAATGGACACACCAAATAAAAATTTAA
                      ____________________________________________________________
consensus GCCATCTTCAATGGAGTTGGTGGGAGAGGGAAGAAATGGACACACCAAATAAAAATTTAA
 
. : . : . : . : . : . :
JMSF031E21+ AAAAAAATTAAAAAGGAGAGGGTAGGCTACTTTTTTAGGTTTTGGTTAAGTGT
JMSF043O24+ AAAAAAATTAAAAAGGAGAGGGTAGGCTACTTTTTTAGGTTTTGGTTAAGTGTGTCCTGC
                      ____________________________________________________________
consensus AAAAAAATTAAAAAGGAGAGGGTAGGCTACTTTTTTAGGTTTTGGTTAAGTGTGTCCTGC