Previous Contig 007581:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS075A12Sequence627007581 (2)
JMSF043N24Sequence764007581 (2)683008425 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043N24+ AATTGGGAAGTATCATTTGATGCCGAGTCTTGGGGCCAAGTAGT
                      ____________________________________________________________
consensus AATTGGGAAGTATCATTTGATGCCGAGTCTTGGGGCCAAGTAGT
 
. : . : . : . : . : . :
JMFS075A12+ CACAGCGACTC
JMSF043N24+ TTCTTTGCCTTGGAAGAAATGCTCGAAGATGAAGGCAACCCGCCATCCACACAGCGACTC
                      ____________________________________________________________
consensus TTCTTTGCCTTGGAAGAAATGCTCGAAGATGAAGGCAACCCGCCATCCACACAGCGACTC
 
. : . : . : . : . : . :
JMFS075A12+ ATCGACAAGGGCGAAAGTCTCCGATTGTTTCTCTCCTCACCAAATTGACCCGTTCCCGAA
JMSF043N24+ ATCGACAAGGGCGAAAGTCTCCGATTGTTTCTCTCCTCACCAAATTGACCCGTTCCCGAA
                      ____________________________________________________________
consensus ATCGACAAGGGCGAAAGTCTCCGATTGTTTCTCTCCTCACCAAATTGACCCGTTCCCGAA
 
. : . : . : . : . : . :
JMFS075A12+ TTACAATACGCATGTGTCCGTTTCACTGAGCGAGCCTTTTTTGGGATATGAAGGCCGATA
JMSF043N24+ TTACAATACGCATATGTCCGTTTCACTGAGCGAGCCTTTTTTGGGATATGAAGGCCGATA
                      ____________________________________________________________
consensus TTACAATACGCATGTGTCCGTTTCACTGAGCGAGCCTTTTTTGGGATATGAAGGCCGATA
 
. : . : . : . : . : . :
JMFS075A12+ ATCTCATTAGCCGGCGACGACTTTGCTGCTACTCTGGCCGGAGCAACAGTCCTCCGTTGA
JMSF043N24+ ATCTCATTAGCCGGCGACGACTTTGCTGCTACTCTGGCCGGAGCAACAGTCCTCCGTTGA
                      ____________________________________________________________
consensus ATCTCATTAGCCGGCGACGACTTTGCTGCTACTCTGGCCGGAGCAACAGTCCTCCGTTGA
 
. : . : . : . : . : . :
JMFS075A12+ CGAATCGACATAGAAGATGACGGCAACGTTTGCTTTGGAGGAGGATTCGGACTCCGATGA
JMSF043N24+ CGAATCGACATAGAAGATGACGGCAACGTTTGCTTTGGAGGAGGATTCGGACTCCGATGA
                      ____________________________________________________________
consensus CGAATCGACATAGAAGATGACGGCAACGTTTGCTTTGGAGGAGGATTCGGACTCCGATGA
 
. : . : . : . : . : . :
JMFS075A12+ ACTTTACGTTCTTCCTCTTCTCCGTTGTTCTCCGAGCTCCCATCGCTCCCGGTGCAACTC
JMSF043N24+ ACTTTACGTTCTTCCTCTTCTCCGTTGTTCTCCGAGCTCCCATCGCTCCCGGTGCAACTC
                      ____________________________________________________________
consensus ACTTTACGTTCTTCCTCTTCTCCGTTGTTCTCCGAGCTCCCATCGCTCCCGGTGCAACTC
 
. : . : . : . : . : . :
JMFS075A12+ GTTCTCTTCCGCTTGCCGTACAATCGATCCCCCTCCTTCTTGCATATTTGTTCTCGATCT
JMSF043N24+ GTTCTCTTCCGCTTGCCGTACAATCGATCCCCCTCCTTCTTGCATATTTGTTCTCGATCT
                      ____________________________________________________________
consensus GTTCTCTTCCGCTTGCCGTACAATCGATCCCCCTCCTTCTTGCATATTTGTTCTCGATCT
 
. : . : . : . : . : . :
JMFS075A12+ CGTAACCTCACTCTTTCATCCATTTCCTTATCTTCCCCAGGTGCATTTCTGACACTGGAA
JMSF043N24+ CGTAACCTCACTCTTTCATCCATTTCCTTATCTTCCCCAGGTGCATTTCTGACACTGGAA
                      ____________________________________________________________
consensus CGTAACCTCACTCTTTCATCCATTTCCTTATCTTCCCCAGGTGCATTTCTGACACTGGAA
 
. : . : . : . : . : . :
JMFS075A12+ ATTCTCTGTCGTAGTTTCGAGATTACGTTGAAGTTCTCCGCACTTGTTCTCCGACCACCT
JMSF043N24+ ATTCTCTGTCGTAGTTTCGAGATTACGTTGAAGTTCTCCGCACTTGTTCTCCGACCACCT
                      ____________________________________________________________
consensus ATTCTCTGTCGTAGTTTCGAGATTACGTTGAAGTTCTCCGCACTTGTTCTCCGACCACCT
 
. : . : . : . : . : . :
JMFS075A12+ ATATTTCTCTCCATGGCCGCCGTCGACTCTCTTTCATCAAACGAAAGAAATAAACAACAA
JMSF043N24+ ATAGTTCTCTCCATGGCCGCCGTCGACTCTCTTTCATCAAACGAAAGAAATAAACAACAA
                      ____________________________________________________________
consensus ATATTTCTCTCCATGGCCGCCGTCGACTCTCTTTCATCAAACGAAAGAAATAAACAACAA
 
. : . : . : . : . : . :
JMFS075A12+ ACTCCGGCGAGAAACTCAACACCGCCGGTCGATTTCTCCGATTCTCAGCTGAGTAAAATC
JMSF043N24+ ACTCCGGCGAGAAACTCAACACCGCCGGTCGATTTCTCCGATTCTCAGCTGAGTAAAATC
                      ____________________________________________________________
consensus ACTCCGGCGAGAAACTCAACACCGCCGGTCGATTTCTCCGATTCTCAGCTGAGTAAAATC
 
. : . : . : . : . : . :
JMFS075A12+ AGAAAAAAACTTCACT
JMSF043N24+ AGAAAAAAACTTCACTGCAAATCTTCTCTCTCTCTCTCTTTTCGGTGTCTCTGACATATC
                      ____________________________________________________________
consensus AGAAAAAAACTTCACTGCAAATCTTCTCTCTCTCTCTCTTTTCGGTGTCTCTGACATATC