Previous Contig 007577:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021E17Sequence541007577 (12)gb:AF334840_17874924e-55Castanea sativa ribosomal protein L33 mRNA, complete cds.670007577 (12)gb:AF334840_17874926e-55Castanea sativa ribosomal protein L33 mRNA, complete cds.
JMFF024A13Sequence371007577 (12)gb:AF334840_17874923e-49Castanea sativa ribosomal protein L33 mRNA, complete cds.701007577 (12)gb:AF334840_17874927e-55Castanea sativa ribosomal protein L33 mRNA, complete cds.
JMFF032O16Sequence614007577 (12)gb:AF334840_17874925e-55Castanea sativa ribosomal protein L33 mRNA, complete cds.649007577 (12)gb:AF334840_17874926e-55Castanea sativa ribosomal protein L33 mRNA, complete cds.
JMSF042D16Sequence717007577 (12)gb:AF334840_17874927e-55Castanea sativa ribosomal protein L33 mRNA, complete cds.674007577 (12)gb:AF334840_17874926e-55Castanea sativa ribosomal protein L33 mRNA, complete cds.
JMSF043N01Sequence745007577 (12)gb:AF334840_17874928e-55Castanea sativa ribosomal protein L33 mRNA, complete cds.679007577 (12)gb:AF334840_17874927e-55Castanea sativa ribosomal protein L33 mRNA, complete cds.
JMSF044N01Sequence678007577 (12)pir|B96771|B967715e-53protein ribosomal protein F1O17.6 [imported] - Arabidopsis thaliana>gb:AE005173_214007577 (12)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF024A13- GCACTCGACTCCGTTAGGCTCCGGCGGTCA
JMFF021E17- CTTTTGCACTCGACTCCGTTAGGCTCCGGCGGTCA
rJMSF042D16+ GCACTCGACTCCGTTAGGCTCCGGCGGTCA
rJMFF021E17+ CCGTTAGGCTCCGGCGGTCA
rJMSF043N01+ GCGGTCA
JMSF044N01- TTAGGCTCCGGCGGTCA
rJMFF032O16+ GACTCCGTTAGGCTCCGGCGGTCA
JMFF032O16- GACTCCGTTAGGCTCCGGCGGTCA
JMSF042D16- GCACTCGACTCCGTTAGGCTCCGGCGGTCA
JMSF043N01- GACTCCGTTAGGCTCCGGCGGTCA
                      ____________________________________________________________
consensus CTTTTGCACTCGACTCCGTTAGGCTCCGGCGGTCA
 
. : . : . : . : . : . :
JMFF024A13- GCAGCAGCGCAACCACCATCCGCCAGCGAAAATGGTTAAGGAACGTCAAGGAGAGCGTGT
JMFF021E17- GCAGCAGCGCAACCACCATCCGCCAGCGAAAATGGTTAAGGAACGTCAAGGAGAGCGTGT
rJMSF042D16+ GCAGCAGCGCAACCACCATCCGCCAGCGAAAATGGTTAAGGAACGTCAAGGAGAGCGTGT
rJMFF021E17+ GCAGCAGCGCAACCACCATCCGCCAGCGAAAATGGTTAAGGAACGTCAAGGAGAGCGTGT
rJMSF043N01+ GCAGCAGCGCAACCACCATCCGCCAGCGAAAATGGTTAAGGAACGTCAAGGAGAGCGTGT
JMSF044N01- GCAGCAGCGCAACCACCATCCGCCAGCGAAAATGGTTAAGGAACGTCAAGGAGAGCGTGT
rJMFF032O16+ GCAACAGCGCAACCACCATCCGCCAGCGAAAATGGTTAAGGAACGTCAAGGAGAGCGTGT
rJMFF024A13+ GAAAATGGTTAAGGAACGTCAAGGAGAGCGTGT
JMFF032O16- GCAACAGCGCAACCACCATCCGCCAGCGAAAATGGTTAAGGAACGTCAAGGAGAGCGTGT
JMSF042D16- GCAGCAGCGCAACCACCATCCGCCAGCGAAAATGGTTAAGGAACGTCAAGGAGAGCGTGT
JMSF043N01- GCAGCAGCGCAACCACCATCCGCCAGCGAAAATGGTTAAGGAACGTCAAGGAGAGCGTGT
                      ____________________________________________________________
consensus GCAGCAGCGCAACCACCATCCGCCAGCGAAAATGGTTAAGGAACGTCAAGGAGAGCGTGT
 
. : . : . : . : . : . :
JMFF024A13- CAGGCTGTATACCAGAGGAACAATTCTAGGTTACAAGAGGTCGAAGTCGAACCAGTATCC
JMFF021E17- CAGGCTGTATACCAGAGGAACAATTCTAGGTTACAAGAGGTCGAAGTCGAACCAGTATCC
rJMSF042D16+ CAGGCTGTATACCAGAGGAACAATTCTAGGTTACAAGAGGTCGAAGTCGAACCAGTATCC
rJMFF021E17+ CAGGCTGTATACCAGAGGAACAATTCTAGGTTACAAGAGGTCGAAGTCGAACCAGTATCC
rJMSF043N01+ CAGGCTGTATACCAGAGGAACAATTCTAGGTTACAAGAGGTCGAAGTCGAACCAGTATCC
JMSF044N01- CAGGCTGTATACCAGAGGAACAATTCTAGGTTACAANAGGTCGAAGTCGAACCAGTATCC
rJMFF032O16+ CAGGCTGTATACCAGAGGAACAATTCTAGGTTACAAGAGGTCGAAGTCGAACCAGTATCC
rJMFF024A13+ CAGGCTGTATACCAGAGGAACAATTCTAGGTTACAAGAGGTCGAAGTCGAACCAGTATCC
JMFF032O16- CAGGCTGTATACCAGAGGAACAATTCTAGGTTACAAGAGGTCGAAGTCGAACCAGTATCC
JMSF042D16- CAGGCTGTATACCAGAGGAACAATTCTAGGTTACAAGAGGTCGAAGTCGAACCAGTATCC
JMSF043N01- CAGGCTGTATACCAGAGGAACAATTCTAGGTTACAAGAGGTCGAAGTCGAACCAGTATCC
                      ____________________________________________________________
consensus CAGGCTGTATACCAGAGGAACAATTCTAGGTTACAAGAGGTCGAAGTCGAACCAGTATCC
 
. : . : . : . : . : . :
JMFF024A13- AAACACGTCGCTTATTCAGATCGAGGGAGTGAACACTAAGGAGGAAGTTGATTGGTACCA
JMFF021E17- AAACACGTCGCTTATTCAGATCGAGGGAGTGAACACTAAGGAGGAAGTTGATTGGTACCA
rJMSF042D16+ AAACACGTCGCTTATTCAGATCGAGGGAGTGAACACTAAGGAGGAAGTTGATTGGTACCA
rJMFF021E17+ AAACACGTCGCTTATTCAGATCGAGGGAGTGAACACTAAGGAGGAAGTTGATTGGTACCA
rJMSF043N01+ AAACACGTCGCTTATTCAGATCGAGGGAGTGAACACTAAGGAGGAAGTTGATTGGTACCA
JMSF044N01- AAACACGTCGCTTATTCAGATCGAGGGAGTGAACACTAANGAGGAAGTTGATTGGTACCA
rJMFF032O16+ AAACACGTCGCTTATTCAGATCGAGGGAGTGAACACTAAGGAGGAAGTTGATTGGTACCA
rJMFF024A13+ AAACACGTCGCTTATTCAGATCGAGGGAGTGAACACTAAGGAGGAAGTTGATTGGTACCA
JMFF032O16- AAACACGTCGCTTATTCAGATCGAGGGAGTGAACACTAAGGAGGAAGTTGATTGGTACCA
JMSF042D16- AAACACGTCGCTTATTCAGATCGAGGGAGTGAACACTAAGGAGGAAGTTGATTGGTACCA
JMSF043N01- AAACACGTCGCTTATTCAGATCGAGGGAGTGAACACTAAGGAGGAAGTTGATTGGTACCA
                      ____________________________________________________________
consensus AAACACGTCGCTTATTCAGATCGAGGGAGTGAACACTAAGGAGGAAGTTGATTGGTACCA
 
. : . : . : . : . : . :
JMFF024A13- GGGAAAGCGTATGGCGTACGTGTACAAGGCCAAAACGAAGAAGAGCGGCTCTCACTACCG
JMFF021E17- GGGAAAGCGTATGGCGTACGTGTACAAGGCCAAAACGAAGAAGAGCGGCTCTCACTACCG
rJMSF042D16+ GGGAAAGCGTATGGCGTACGTGTACAAGGCCAAAACGAAGAAGAGCGGCTCTCACTACCG
rJMFF021E17+ GGGAAAGCGTATGGCGTACGTGTACAAGGCCAAAACGAAGAAGAGCGGCTCTCACTACCG
rJMSF043N01+ GGGAAAGCGTATGGCGTACGTGTACAAGGCCAAAACGAAGAAGAGCGGCTCTCACTACCG
JMSF044N01- GGGAAAGCGTATGGCGTACGTGTACAAGGCCAAAACGAAGAAGAGCGGCTCTCACTACCG
rJMFF032O16+ GGGAAAGCGTATGGCGTACGTGTACAAGGCCAAAACGAAGAAGAGCGGCTCTCACTACCG
rJMFF024A13+ GGGAAAGCGTATGGCGTACGTGTACAAGGCCAAAACGAAGAAGAGCGGCTCTCACTACCG
JMFF032O16- GGGAAAGCGTATGGCGTACGTGTACAAGGCCAAAACGAAGAAGAGCGGCTCTCACTACCG
JMSF042D16- GGGAAAGCGTATGGCGTACGTGTACAAGGCCAAAACGAAGAAGAGCGGCTCTCACTACCG
JMSF043N01- GGGAAAGCGTATGGCGTACGTGTACAAGGCCAAAACGAAGAAGAGCGGCTCTCACTACCG
                      ____________________________________________________________
consensus GGGAAAGCGTATGGCGTACGTGTACAAGGCCAAAACGAAGAAGAGCGGCTCTCACTACCG
 
. : . : . : . : . : . :
JMFF024A13- CTGCATCTGGGGAAAGGTCTGCAGGCCTCACGGCAATAGCGGCGTTGTTAGAGCTAAGTT
JMFF021E17- CTGCATCTGGGGAAAGGTCTGCAGGCCTCACGGCAATAGCGGCGTTGTTAGAGCTAAGTT
rJMSF042D16+ CTGCATCTGGGGAAAGGTCTGCAGGCCTCACGGCAATAGCGGCGTTGTTAGAGCTAAGTT
rJMFF021E17+ CTGCATCTGGGGAAAGGTCTGCAGGCCTCACGGCAATAGCGGCGTTGTTAGAGCTAAGTT
rJMSF043N01+ CTGCATCTGGGGAAAGGTCTGCAGGCCTCACGGCAATAGCGGCGTTGTTAGAGCTAAGTT
JMSF044N01- CTGCATCTGGGGAAAGGTCTGCAGGCCTCACGGCAATAGCGGCGTTGTTAGAGCTAAGTT
rJMFF032O16+ CTGCATCTGGGGAAAGGTCTGCAGGCCTCACGGCAATAGCGGCGTTGTTAGAGCTAAGTT
rJMFF024A13+ CTGCATCTGGGGAAAGGTCTGCAGGCCTCACGGCAATAGCGGCGTTGTTAGAGCTAAGTT
JMFF032O16- CTGCATCTGGGGAAAGGTCTGCAGGCCTCACGGCAATAGCGGCGTTGTTAGAGCTAAGTT
JMSF042D16- CTGCATCTGGGGAAAGGTCTGCAGGCCTCACGGCAATAGCGGCGTTGTTAGAGCTAAGTT
JMSF043N01- CTGCATCTGGGGAAAGGTCTGCAGGCCTCACGGCAATAGCGGCGTTGTTAGAGCTAAGTT
                      ____________________________________________________________
consensus CTGCATCTGGGGAAAGGTCTGCAGGCCTCACGGCAATAGCGGCGTTGTTAGAGCTAAGTT
 
. : . : . : . : . : . :
JMFF024A13- CAAGTCCAATCTTCCGCCTAAATCCATGGGAGATAA
JMFF021E17- CAAGTCCAATCTTCCGCCTAAATCCATGGGAGATAAGGTTAGGGTGTTCATGTATCCAAG
rJMSF042D16+ CAAGTCCAATCTTCCGCCTAAATCCATGGGAGATAAGGTTAGGGTGTTCATGTATCCAAG
rJMFF021E17+ CAAGTCCAATCTTCCGCCTAAATCCATGGGAGATAAGGTTAGGGTGTTCATGTATCCAAG
rJMSF043N01+ CAAGTCCAATCTTCCGCCTAAATCCATGGGAGATAAGGTTAGGGTGTTCATGTATCCAAG
JMSF044N01- CAAGTCCAATCTTCCGCCTAAATCCATGGNAGATAAGGTTAGGGTGTTCATGTATCCNAG
rJMFF032O16+ CAAGTCCAATCTTCCGCCTAAATCCATGGGAGATAAGGTTAGGGTGTTCATGTATCCAAG
rJMFF024A13+ CAAGTCCAATCTTCCGCCTAAATCCATGGGAGATAAGGTTAGGGTGTTCATGTATCCAAG
JMFF032O16- CAAGTCCAATCTTCCGCCTAAATCCATGGGAGATAAGGTTAGGGTGTTCATGTATCCAAG
rJMSF044N01+ CCATGGGAGATAAGGTTAGGGTNTTCATGTATCCAAG
JMSF042D16- CAAGTCCAATCTTCCGCCTAAATCCATGGGAGATAAGGTTAGGGTGTTCATGTATCCAAG
JMSF043N01- CAAGTCCAATCTTCCGCCTAAATCCATGGGAGATAAGGTTAGGGTGTTCATGTATCCAAG
                      ____________________________________________________________
consensus CAAGTCCAATCTTCCGCCTAAATCCATGGGAGATAAGGTTAGGGTGTTCATGTATCCAAG
 
. : . : . : . : . : . :
JMFF021E17- CAACATATAAGCAGGGAAGGTGAAGATGCCAGATTCAAGGTCATCAGTGAGTTATAGGAC
rJMSF042D16+ CAACATATAAGCAGGGAAGGTGAAGATGCCAGATTCAAGGTCATCAGTGAGTTATAGGAC
rJMFF021E17+ CAACATATAAGCAGGGAAGGTGAAGATGCCAGATTCAAGGTCATCAGTGAGTTATAGGAC
rJMSF043N01+ CAACATATAAGCAGGGAAGGTGAAGATGCCAGATTCAAGGTCATCAGTGAGTTATAGGAC
JMSF044N01- CAACATATAAGCANGGAAGGTGAAGATGCCAGATTCAAGGTCATCANTGAGTTATAGGAC
rJMFF032O16+ CAACATATA---AGGGAAGGTGAAGATGCCAGATTCAAGGTCATCAGTGAGTTATAGGAC
rJMFF024A13+ CAACATATAAGCAGGGAAGGTGAAGATGCCAGATTCAAGGTCATCAGTGAGTTATAGGAC
JMFF032O16- CAACATATA---AGGGAAGGTGAAGATGCCAGATTCAAGGTCATCAGTGAGTTATAGGAC
rJMSF044N01+ CAACATATAAGCAGGGAAGGTGAAGATGCCAGNTTCAAGGTCATCAGTGAGTCATAGGAC
JMSF042D16- CAACATATAAGCAGGGAAGGTGAAGATGCCAGATTCAAGGTCATCAGTGAGTTATAGGAC
JMSF043N01- CAACATATAAGCAGGGAAGGTGAAGATGCCAGATTCAAGGTCATCAGTGAGTTATAGGAC
                      ____________________________________________________________
consensus CAACATATAAGCAGGGAAGGTGAAGATGCCAGATTCAAGGTCATCAGTGAGTTATAGGAC
 
. : . : . : . : . : . :
JMFF021E17- TGCATCCTAACAAAATAGATAGAGTTTACTGCCCTGTGTTCTGCGGAATTCTTTTTAGCC
rJMSF042D16+ TGCATCCTAACAAAATAGATAGAGTTTACTGCCCTGTGTTCTGCGGAATTCTTTTTAGCC
rJMFF021E17+ TGCATCCTAACAAAATAGATAGAGTTTACTGCCCTGTGTTCTGCGGAATTCTTTTTAGCC
rJMSF043N01+ TGCATCCTAACAAAATAGATAGAGTTTACTGCCCTGTGTTCTGCGGAATTCTTTTTAGCC
JMSF044N01- TGCATCCTAACAAAATAGATANAGTTTACTGCCCTGTGTTCTGCGGAATTCTTTTTANCC
rJMFF032O16+ TGCATCCTAACAAAATAGATAGAGTTTACTGCCCTGTGTTCTGCGGAATTCTTTTTAGCC
rJMFF024A13+ TGCATCCTAACAAAATAGATAGAGTTTACTGCCCTGTGTTCTGCGGAATTCTTTTTAGCC
JMFF032O16- TGCATCCTAACAAAATAGATAGAGTTTACTGCCCTGTGTTCTGCGGAATTCTTTTTAGCC
rJMSF044N01+ TGCATCCTAACAAAANNGATAGAGTTTACTGCCCCGTGTTNTGCGGAATTCTTTTTAGCC
JMSF042D16- TGCATCCTAACAAAATAGATAGAGTTTACTGCCCTGTGTTCTGCGGAATTCTTTTTAGCC
JMSF043N01- TGCATCCTAACAAAATAGATAGAGTTTACTGCCCTGTGTTCTGCGGAATTCTTTTTAGCC
                      ____________________________________________________________
consensus TGCATCCTAACAAAATAGATAGAGTTTACTGCCCTGTGTTCTGCGGAATTCTTTTTAGCC
 
. : . : . : . : . : . :
JMFF021E17- TCTTTGTCCTTGTTTTGAGTAATAGA
rJMSF042D16+ TCTTTGTCCTTGTTTTGAGTAATAGAAATGATTGTAGTTTGGAGTTTTCTCGTGATTATA
rJMFF021E17+ TCTTTGTCCTTGTTTTGAGTAATAGAAATGATTGTAGTTTGGAGTTTTCTCGTGATTATA
rJMSF043N01+ TCTTTGTCCTTGTTTTGAGTAATAGAAATGATTGTAGTTTGGAGTTTTCTCGTGATTATA
JMSF044N01- TCTTTGTCCTTGTTTTGAGTAATAGAAATGATTGTAGTTTGGAGTTTTCTCGTGATTATA
rJMFF032O16+ TCTTTGTCCTTGTTTTGAGTAATAGAAATGATTGTAGTTTGGAGTTTTCTCGTGATTATA
rJMFF024A13+ TCTTTGTCCTTGTTTTGAGTAATAGAAATGATTGTAGTTTGGAGTTTTCTCGTGATTATA
JMFF032O16- TCTTTGTCCTTGTTTTGAGTAATAGAAATGATTGTAGTTTGGAGTTTTCTCGTGATTATA
rJMSF044N01+ TCTTTGTCCNTGTTTTGAGTAATAGAAATGATNGTAGTTCGGAGTTTT
JMSF042D16- TCTTTGTCCTTGTTTTGAGTAATAGAAATGATTGTAGTTTGGAGTTTTCTCGTGATTATA
JMSF043N01- TCTTTGTCCTTGTTTTGAGTAATAGAAATGATTGTAGTTTGGAGTTTTCTCGTGATTATA
                      ____________________________________________________________
consensus TCTTTGTCCTTGTTTTGAGTAATAGAAATGATTGTAGTTTGGAGTTTTCTCGTGATTATA
 
. : . : . : . : . : . :
rJMSF042D16+ TGCTACATGCTCATTTTGGAGTTTTCTCGTGTATGCGTATACTACTGTTAATGTTTAACT
rJMFF021E17+ TGCTACATGCTCATTTTGGAGTTTTCTCGTGTATGCGTATACTACTGTTAATGTTTAACT
rJMSF043N01+ TGCTACATGCTCATTTTGGAGTTTTCTCGTGTATGCGTATACTACTGTTAATGTTTAACT
JMSF044N01- TGCTACATGCTCATTTTGGAGTTTTCTCGTGTATGCGTATACTACTGTTAATGTTTAACT
rJMFF032O16+ TGCTACATGCTCATTTTGGAGTTTTCTCGTGTATGCGTATACTACTGTTAATGTTTAACT
rJMFF024A13+ TGCTACATGCTCATTTTGGAGTTTTCTCGTGTATGCGTATACTACTGTTAATGTTTAACT
JMFF032O16- TGCTACATGCTCATTTTGGAGTTTTCTCGTGTATGCGTATACTACTGTTAATG
JMSF042D16- TGCTACATGCTCATTTTGGAGTTTTCTCGTGTATGCGTATACTACTGTTAATGTTTAACT
JMSF043N01- TGCTACATGCTCATTTTGGAGTTTTCTCGTGTATGCGTATACTACTGTTAATGTTTAACT
                      ____________________________________________________________
consensus TGCTACATGCTCATTTTGGAGTTTTCTCGTGTATGCGTATACTACTGTTAATGTTTAACT
 
. : . : . : . : . : . :
rJMSF042D16+ ATGGCTTTGGCAGATCCTACTAGCCATATGGAATTTGCACAT
rJMFF021E17+ ATGGCTTTGGCAGATCCTACTAGCCATATGGAATTTGCACATTTTTATAC
rJMSF043N01+ ATGGCTTTGGCAGATCCTACTAGCCATATGGAATTTGCACATTTTTATACCAAA-TGAAG
JMSF044N01- ATGGCTTTGGCAGATCCTACTAGCCATATGGAATTTGCNCATTTTTATACCA
rJMFF032O16+ ATGGCTTTGGCAGATCCTACTAGCCATA
rJMFF024A13+ ATGGCTTTGGCAGATCCTACTAGCCATATGGAATTTGCACATTTTTATACCAAAT
JMSF042D16- ATGGCTTTGGCAGATCCTACTAGCCATATGGAATTTGCACATTTTTATACCAAATTGAAG
JMSF043N01- ATGGCTTTGGCAGATCCTACTAGCCATATGGAATTTGCACATTTTTATACCAAATTGAAG
                      ____________________________________________________________
consensus ATGGCTTTGGCAGATCCTACTAGCCATATGGAATTTGCACATTTTTATACCAAATTGAAG
 
. : . : . : . : . : . :
rJMSF043N01+ AGTGTATTT
JMSF042D16- AGTGTATTTTGAGCGAAA
JMSF043N01- AGTGTATTTTGAGTGAAACTACCACTTTAATTTGAATTTTTTATTGGTGTAAAAAAAAAA
                      ____________________________________________________________
consensus AGTGTATTTTGAGTGAAACTACCACTTTAATTTGAATTTTTTATTGGTGTAAAAAAAAAA