Previous Contig 007576:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004J22Sequence345007576 (7)225007576 (7)gb:AC103550_17372770.041Oryza sativa chromosome 3 BAC OSJNBa0079G12 genomic sequence, complete sequence.
JMSF004J24Sequence286007576 (7)gb:AC103550_17372773e-05Oryza sativa chromosome 3 BAC OSJNBa0079G12 genomic sequence, complete sequence.
JMSF043M22Sequence613007576 (7)gb:AC103550_17372774e-10Oryza sativa chromosome 3 BAC OSJNBa0079G12 genomic sequence, complete sequence.565007576 (7)gb:AC103550_17372773e-10Oryza sativa chromosome 3 BAC OSJNBa0079G12 genomic sequence, complete sequence.
JMSF045G14Sequence613007576 (7)gb:AC103550_17372774e-10Oryza sativa chromosome 3 BAC OSJNBa0079G12 genomic sequence, complete sequence.576007576 (7)gb:AC103550_17372773e-10Oryza sativa chromosome 3 BAC OSJNBa0079G12 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF004J22- GGGAAG
                      ____________________________________________________________
consensus GGGAAG
 
. : . : . : . : . : . :
JMSF004J22- GGAAAAGTCCTGTGAGTCTCAGGAGGATTGGGATTTTCCATATTTACTCTCCCCTGATGA
JMSF045G14- GACTCTCCCCTGATGA
rJMSF045G14+ GACTCTCCCCTGATGA
rJMSF043M22+ GACTCTCCCCTGATGA
JMSF043M22- GACTCTCCCCTGATGA
                      ____________________________________________________________
consensus GGAAAAGTCCTGTGAGTCTCAGGAGGATTGGGATTTTCCATATTGACTCTCCCCTGATGA
 
. : . : . : . : . : . :
JMSF004J22- CTTAGAAAGAAATAAAGAAAGACAGATTCATCATGCTGATATCTGCTATAAACTATGTTT
JMSF045G14- CTTAGAAAGAAATAAAGAAAGACAGATTCATCATGCTGATATCTGCTATAAACTATGTTT
rJMSF045G14+ CTTAGAAAGAAATAAAGAAAGACAGATTCATCATGCTGATATCTGCTATAAACTATGTTT
rJMSF043M22+ CTTAGAAAGAAATAAAGAAAGACAGATTCATCATGCTGATATCTGCTATAAACTATGTTT
JMSF043M22- CTTAGAAAGAAATAAAGAAAGACAGATTCATCATGCTGATATCTGCTATAAACTATGTTT
                      ____________________________________________________________
consensus CTTAGAAAGAAATAAAGAAAGACAGATTCATCATGCTGATATCTGCTATAAACTATGTTT
 
. : . : . : . : . : . :
JMSF004J22- CAGGAGCACTATATGTAAAGGGAGCAGACACCCGAGAAAGACGAAACATTACA-GAAGAG
JMSF045G14- CAGGAGCACTATATGTAAAGGGAGCAGACACCCGAGAAAGACGAAACATTACAGGAAGAG
rJMSF045G14+ CAGGAGCACTATATGTAAAGGGAGCAGACACCCGAGAAAGACGAAACATTACAGGAAGAG
rJMSF043M22+ CAGGAGCACTATATGTAAAGGGAGCAGACACCCGAGAAAGACGAAACATTACAGGAAGAG
JMSF043M22- CAGGAGCACTATATGTAAAGGGAGCAGACACCCGAGAAAGACGAAACATTACAGGAAGAG
                      ____________________________________________________________
consensus CAGGAGCACTATATGTAAAGGGAGCAGACACCCGAGAAAGACGAAACATTACAGGAAGAG
 
. : . : . : . : . : . :
JMSF004J22- TGAAGGCGCAAGGCAGGAGAGAGCTTCTCTTTTCGACATTAGCAGCTGTCGAAATCAGTG
JMSF045G14- TGAAGGCGCAAGGCAGGAGAGAGCTTCTCTTTTCGACATTAGCAGCTGTCGAAATCAGTG
rJMSF045G14+ TGAAGGCGCAAGGCAGGAGAGAGCTTCTCTTTTCGACATTAGCAGCTGTCGAAATCAGTG
rJMSF043M22+ TGAAGGCGCAAGGCAGGAGAGAGCTTCTCTTTTCGACATTAGCAGCTGTCGAAATCAGTG
rJMSF004J22+ TTAGCAGCNGTNGAAATCAGTG
rJMSF004J24+ GACATTAGCAGCTGTCGAAATCAGTG
JMSF043M22- TGAAGGCGCAAGGCAGGAGAGAGCTTCTCTTTTCGACATTAGCAGCTGTCGAAATCAGTG
                      ____________________________________________________________
consensus TGAAGGCGCAAGGCAGGAGAGAGCTTCTCTTTTCGACATTAGCAGCTGTCGAAATCAGTG
 
. : . : . : . : . : . :
JMSF004J22- ACTCCNAAACCGAGCTTCTTAACAAGTTTTTAAAGAAATCTGAAGAGAACAAGGAGAAAA
JMSF045G14- ACTCCAAAACCGAGCTTCTTAACAAGTTTTTAAAGAAATCTGAAGAGAACAAGGAGAAAA
rJMSF045G14+ ACTCCAAAACCGAGCTTCTTAACAAGTTTTTAAAGAAATCTGAAGAGAACAAGGAGAAAA
rJMSF043M22+ ACTCCAAAACCGAGCTTCTTAACAAGTTTTTAAAGAAATCTGAAGAGAACAAGGAGAAAA
rJMSF004J22+ ACTCCANAACCGAGCTTCTTNACAAGTTTTTAAAGAAATCTGAAGAGAACAAGGAGAAAA
rJMSF004J24+ NCTCCAAAACCGAGCTTCTTAACAAGTTTTTAAAGAAATCTGAAGAGAACAAGGAGAAAA
JMSF043M22- ACTCCAAAACCGAGCTTCTTAACAAGTTTTTAAAGAAATCTGAAGAGAACAAGGAGAAAA
                      ____________________________________________________________
consensus ACTCCAAAACCGAGCTTCTTAACAAGTTTTTAAAGAAATCTGAAGAGAACAAGGAGAAAA
 
. : . : . : . : . : . :
JMSF004J22- ATGACNAGGAGAGGCTGGAGAGCTACTATNAGCGCA
JMSF045G14- ATGACAAGGAGAGGCTGGAGAGCTACTATAAGCGCAACTACAAAGACTATTTTGGTGTGT
rJMSF045G14+ ATGACAAGGAGAGGCTGGAGAGCTACTATAAGCGCAACTACAAAGACTATTTTGGTGTGT
rJMSF043M22+ ATGACAAGGAGAGGCTGGAGAGCTACTATAAGCGCAACTACAAAGACTATTTTGGTGTGT
rJMSF004J22+ ATGACAAGGAGAGGCTGGAGAGCTCCTATANGCGCAACTACAAAGACTATTTTGGTGTGT
rJMSF004J24+ ATGACAAGGAGAGGCTGGAGAGCTNCTATAAGCGCAACTACAAAGACTATTTTGGTGTGT
JMSF043M22- ATGACAAGGAGAGGCTGGAGAGCTACTATAAGCGCAACTACAAAGACTATTTTGGTGTGT
                      ____________________________________________________________
consensus ATGACAAGGAGAGGCTGGAGAGCTACTATAAGCGCAACTACAAAGACTATTTTGGTGTGT
 
. : . : . : . : . : . :
JMSF045G14- TAGAAGGGACTCTGAGGCAAAAGTTGGAAAACAAAGA-GCAAATTTCTGAATCAGAGCAG
rJMSF045G14+ TAGAAGGGACTCTGAGGCAAAAGTTGGAAAACAAAGA-GCAAATTTCTGAATCAGAGCAG
rJMSF043M22+ TAGAAGGGACTCTGAGGCAAAAGTTGGAAAACAAAGA-GCAAATTTCTGAATCAGAGCAG
rJMSF004J22+ TAGAAGGGACTCTGAGGCAAAANTTGGAAAACAAAGATGCAAATTTCTGAATCAGAGCAG
rJMSF004J24+ TAGAAGGGACTCTGAGGCAAAAGTTGGAAAACAAAGATGCAAATTTCTGAATCAGAGCAG
JMSF043M22- TAGAAGGGACTCTGAGGCAAAAGTTGGAAAACAAAGA-GCAAATTTCTGAATCAGAGCAG
                      ____________________________________________________________
consensus TAGAAGGGACTCTGAGGCAAAAGTTGGAAAACAAAGA-GCAAATTTCTGAATCAGAGCAG
 
. : . : . : . : . : . :
JMSF045G14- AAGATTCTTGAATGGCTTGACAAAAACAAGTAAATTA-CTATGACTAGATGTAAGGGAAT
rJMSF045G14+ AAGATTCTTGAATGGCTTGACAAAAACAAGTAAATTA-CTATGACTAGATGTAAGGGAAT
rJMSF043M22+ AAGATTCTTGAATGGCTTGACAAAAACAAGTAAATTA-CTATGACTAGATGTAAGGGAAT
rJMSF004J22+ AAGATTCTTGAATGGC
rJMSF004J24+ AAGATTCNTGAATGGCTTGACAAAAACAAGTAAATTACCTATGCCTAGACGTAAGGGAAT
JMSF043M22- AAGATTCTTGAATGGCTTGACAAAAACAAGTAAATTA-CTATGACTAGATGTAAGGGAAT
                      ____________________________________________________________
consensus AAGATTCTTGAATGGCTTGACAAAAACAAGTAAATTA-CTATGACTAGATGTAAGGGAAT
 
. : . : . : . : . : . :
JMSF045G14- ATGTCTGTTCAGATAAATCTTGTGTTTCGAAGCAAAGTTAAAGCATTTGAAATGCAGAGA
rJMSF045G14+ ATGTCTGTTCAGATAAATCTTGTGTTTCGAAGCAAAGTTAAAGCATTTGAAATGCAGAGA
rJMSF043M22+ ATGTCTGTTCAGATAAATCTTGTGTTTCGAAGCAAAGTTAAAGCATTTGAAATGCAGAGA
rJMSF004J24+ ATGTCTGTTCAGATAAATCT
JMSF043M22- ATGTCTGTTCAGATAAATCTTGTGTTTCGAAGCAAAGTTAAAGCATTTGAAATGCAGAGA
                      ____________________________________________________________
consensus ATGTCTGTTCAGATAAATCTTGTGTTTCGAAGCAAAGTTAAAGCATTTGAAATGCAGAGA
 
. : . : . : . : . : . :
JMSF045G14- TAGAGCAATCAAGAACATTGGCACCCACGGTTTTTCCCTCATTCTGCTACTTCATTT-CA
rJMSF045G14+ TAGAGCAATCAAGAACATTGGCACCCACGGTTTTTCCCTCATTCTGCTACTTCATTT-CA
rJMSF043M22+ TAGAGCAATCAAGAACATTGGCACCCACGGTTTTTCCCTCATTCTGCTACTTCATTTCCA
JMSF043M22- TAGAGCAATCAAGAACATTGGCACCCACGGTTTTTCCCTCATTCTGCTACTTCATTT-CA
                      ____________________________________________________________
consensus TAGAGCAATCAAGAACATTGGCACCCACGGTTTTTCCCTCATTCTGCTACTTCATTT-CA
 
. : . : . : . : . : . :
JMSF045G14- ATCTGTGTATTTGCTTTAATTTCGGGTTGGGTATTGATGAACTACAAGCTAAAAAAAAAA
rJMSF045G14+ ATCTGTGTATTTGCTT
rJMSF043M22+ ATCTGTGTATT
JMSF043M22- ATCTGTGTATTTGCTTTAATTTCGGGTTGGGTATTGATGAACTACAAGCTAAAAAAAAAA
                      ____________________________________________________________
consensus ATCTGTGTATTTGCTTTAATTTCGGGTTGGGTATTGATGAACTACAAGCTAAAAAAAAAA