Previous Contig 007566:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS151C08Sequence617007566 (3)
JMSF041I04Sequence776007566 (3)838013350 (2)gb:AJ844614_18147236e-19Plantago major partial mRNA for hypothetical protein.
JMSF043J19Sequence774007566 (3)699013350 (2)gb:AJ844614_18147236e-19Plantago major partial mRNA for hypothetical protein.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041I04+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMSF041I04+ GAAGAGCCTTGTCAAAATCCTCTATAAACCCTTCAAACACAATCACGAAAACAGATCGGA
JMSF043J19+ CCTTGTCAAAATCCTCTATNAACCCTTCAAACACANTCACGAAAACAGATCGGA
                      ____________________________________________________________
consensus GAAGAGCCTTGTCAAAATCCTCTATAAACCCTTCAAACACAATCACGAAAACAGATCGGA
 
. : . : . : . : . : . :
JMSF041I04+ TTATCAGAGTAACCGATCTTTTGGAGAATGAACCTTGGAAAAATCCTCTATAAACCCCTC
JMSF043J19+ TTATCAGAGTAACCGATCTTTTGGAGAATGAACCTTGGAAAAATCCTCTATAAACCCCTC
                      ____________________________________________________________
consensus TTATCAGAGTAACCGATCTTTTGGAGAATGAACCTTGGAAAAATCCTCTATAAACCCCTC
 
. : . : . : . : . : . :
JMFS151C08+ TCGACCTGATTATCAGCAGAATATATC-TTCGAAGAATGAACC-
JMSF041I04+ AATCACAACCACAAAATCGACCTGATTATCAGCAGAATATATCTTTCGAAGAATGAACCT
JMSF043J19+ AATCACAACCACAAAATCGACCTGATTATCAGCAGAATATATCTTTCGAAGAATGAACCT
                      ____________________________________________________________
consensus AATCACAACCACAAAATCGACCTGATTATCAGCAGAATATATCTTTCGAAGAATGAACCT
 
. : . : . : . : . : . :
JMFS151C08+ TGTCAAAATCCCCAATAAACTCCTTAACCACGAATCACAAAGAAGACCTTATTATCAAGG
JMSF041I04+ TGTCAAAATCCCCAATAAACTCCTTAACCACGAATCACAAAGAAGACCTTATTATCAAGG
JMSF043J19+ TGTCAAAATCCCCAATAAACTCCTTAACCACGAATCACAAAGAAGACCTTATTATCAAGG
                      ____________________________________________________________
consensus TGTCAAAATCCCCAATAAACTCCTTAACCACGAATCACAAAGAAGACCTTATTATCAAGG
 
. : . : . : . : . : . :
JMFS151C08+ GAATGATCCTTTGAAGAATAAATCCAGCAATCACAAAATCAACCCGATTAACGATCAAAA
JMSF041I04+ GAATGATCCTTTGAAGAATAAATCCAGCAATCACAAAATCAACCCGATTAACGATCAAAA
JMSF043J19+ GAATGATCCTTTGAAGAATAAATCCAGCAATCACAAAATCAACCCGATTAACGATCAAAA
                      ____________________________________________________________
consensus GAATGATCCTTTGAAGAATAAATCCAGCAATCACAAAATCAACCCGATTAACGATCAAAA
 
. : . : . : . : . : . :
JMFS151C08+ GCGAAGACCGACCATATTTTCCGAGAAAAAAAGAAGCAGCTAAACCGTCCTACCGTAGCA
JMSF041I04+ GCGAAGACCGACCATATTTTCCGAGAAAAAAAGAAGCAGCTAAACCGTCCTACCGTAGCA
JMSF043J19+ GCGAAGACCGACCATATTTTCCGAGAAAAAAAGAAGCAGCTAAACCGTCCTACCGTAGCA
                      ____________________________________________________________
consensus GCGAAGACCGACCATATTTTCCGAGAAAAAAAGAAGCAGCTAAACCGTCCTACCGTAGCA
 
. : . : . : . : . : . :
JMFS151C08+ TCTAGAAGGGACAAGGACAACGTAAAGGAGGAAGAGAAAGATAACCAAGGAGAAAGCAAA
JMSF041I04+ TCTAGAAGGGACAAGGACAACGTAAAGGAGGAAGAGAAAGATAACCAAGGAGAAAGCAAA
JMSF043J19+ TCTAGAAGGGACAAGGACAACGTAAAGGAGGAAGAGAAAGATAACCAAGGAGAAAGCAAA
                      ____________________________________________________________
consensus TCTAGAAGGGACAAGGACAACGTAAAGGAGGAAGAGAAAGATAACCAAGGAGAAAGCAAA
 
. : . : . : . : . : . :
JMFS151C08+ TGTTAACTAATACTACTACACCGAGGTTTCAGACGATGAAAACACAAGACGCCATAGAAG
JMSF041I04+ TGTTAACTAATACTACTACACCGAGGTTTCAGACGATGAAAACACAAGACGCCATAGAAG
JMSF043J19+ TGTTAACTAATACTACTACACCGAGGTTTCAGACGATGAAAACACAAGACGCCATAGAAG
                      ____________________________________________________________
consensus TGTTAACTAATACTACTACACCGAGGTTTCAGACGATGAAAACACAAGACGCCATAGAAG
 
. : . : . : . : . : . :
JMFS151C08+ CAGGTAGCATACGGACTGATGACGAGCAGATCGAGCAAGAAAGAAGGCACCGACATCGTT
JMSF041I04+ CAGGTAGCATACGGACTGATGACGAGCAGATCGAGCAAGAAAGAAGGCACCGACATCGTT
JMSF043J19+ CAGGTAGCATACGGACTGATGACGAGCAGATCGAGCAAGAAAGAAGGCACCGACATCGTT
                      ____________________________________________________________
consensus CAGGTAGCATACGGACTGATGACGAGCAGATCGAGCAAGAAAGAAGGCACCGACATCGTT
 
. : . : . : . : . : . :
JMFS151C08+ TGATTCGATGCTCTTCGATTTGATACTGTTTTCCCCTAAACCCTAAAAATCAAAAGCTTA
JMSF041I04+ TGATTCGATGCTCTTCGATTTGATACTGTTTTCCCCTAAACCCTAAAAATCAAAAGCTTA
JMSF043J19+ TGATTCGATGCTCTTCGATTTGATACTGTTTTCCCCTAAACCCTAAAAATCAAAAGCTTA
                      ____________________________________________________________
consensus TGATTCGATGCTCTTCGATTTGATACTGTTTTCCCCTAAACCCTAAAAATCAAAAGCTTA
 
. : . : . : . : . : . :
JMFS151C08+ CCACTCTCAAACCGATCGGCGAAGATGTAAATCCGGATGTGAAGAAATGGATTGTTGAAT
JMSF041I04+ CCACTCTCAAACCGATCGGCGAAGATGTAAATCCGGATGTGAAGAAATGGATTGTTGAAT
JMSF043J19+ CCACTCTCAAACCGATCGGCGAAGATGTAAATCCGGATGTGAAGAAATGGATTGTTGAAT
                      ____________________________________________________________
consensus CCACTCTCAAACCGATCGGCGAAGATGTAAATCCGGATGTGAAGAAATGGATTGTTGAAT
 
. : . : . : . : . : . :
JMFS151C08+ TTCGTGAAACTGAGGAATAAATACTGATTGAAACAGAGATCGCGATTACATCGGCGTGGA
JMSF041I04+ TTCGTGAAACTGAGGAATAAATACTGATTGAAACAGAGATCGCGATTACATCGGCGTGGA
JMSF043J19+ TTCGTGAAACTGAGGAATAAATACTGATTGAAACAGAGATCGCGATTACATCGGCGTGGA
                      ____________________________________________________________
consensus TTCGTGAAACTGAGGAATAAATACTGATTGAAACAGAGATCGCGATTACATCGGCGTGGA
 
. : . : . : . : . : . :
JMFS151C08+ AATGGAACGAATCATGAGACTTGAAGACGAAGAAA
JMSF041I04+ AATGGAACGAATCATGAGACTTGAAGACGAAGAAATTGGATCGAGCAGAAATGC
JMSF043J19+ AATGGAACGAATCATGAGACTTGAAGACGAAGAAATTGGATCGAGCAGAAATGCATTTCC
                      ____________________________________________________________
consensus AATGGAACGAATCATGAGACTTGAAGACGAAGAAATTGGATCGAGCAGAAATGCATTTCC