Previous Contig 007565:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002A03Sequence551007565 (27)gb:AB063192_15222067e-15Cucumis melo CmEIL2 mRNA for EIN3-like protein, complete cds.730008956 (28)gb:AY248907_15926421e-22Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF003G13Sequence512007565 (27)721008956 (28)gb:AY248907_15926421e-22Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF006D17Sequence501007565 (27)gb:AB063192_15222061e-04Cucumis melo CmEIL2 mRNA for EIN3-like protein, complete cds.808008956 (28)gb:AY248907_15926421e-46Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF007O05Sequence582007565 (27)gb:AB063192_15222062e-04Cucumis melo CmEIL2 mRNA for EIN3-like protein, complete cds.722008956 (28)gb:AY248907_15926428e-22Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF010D03Sequence554007565 (27)gb:AB063192_15222063e-15Cucumis melo CmEIL2 mRNA for EIN3-like protein, complete cds.699008956 (28)gb:AY248907_15926421e-23Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF013G17Sequence553007565 (27)gb:AB063192_15222069e-15Cucumis melo CmEIL2 mRNA for EIN3-like protein, complete cds.726008956 (28)gb:AY248907_15926421e-22Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF016D10Sequence513007565 (27)578008956 (28)gb:AY248907_15926428e-12Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF020A09Sequence453007565 (27)699008956 (28)gb:AY248907_15926424e-24Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF021P02Sequence417007565 (27)gb:AF328786_17869135e-08Lycopersicon esculentum EIL3 (EIL3) mRNA, complete cds.
JMFF027L04Sequence511007565 (27)670008956 (28)gb:AY248907_15926422e-20Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF028L10Sequence493007565 (27)gb:AB063192_15222064e-04Cucumis melo CmEIL2 mRNA for EIN3-like protein, complete cds.656008956 (28)gb:AY248907_15926421e-20Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF030J24Sequence178007565 (27)614008956 (28)gb:AY248907_15926422e-12Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF030L07Sequence448007565 (27)698008956 (28)gb:AY248907_15926421e-23Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF033I04Sequence450007565 (27)gb:AF328786_17869132e-09Lycopersicon esculentum EIL3 (EIL3) mRNA, complete cds.719008956 (28)gb:AY248907_15926421e-21Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF033N01Sequence452007565 (27)707008956 (28)gb:AY248907_15926421e-23Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF035B11Sequence469007565 (27)694008956 (28)gb:AY248907_15926429e-23Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF036B12Sequence457007565 (27)680008956 (28)gb:AY248907_15926427e-20Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF039A16Sequence497007565 (27)gb:AF328786_17869133e-04Lycopersicon esculentum EIL3 (EIL3) mRNA, complete cds.
JMFF043A15Sequence632007565 (27)gb:AB063192_15222068e-30Cucumis melo CmEIL2 mRNA for EIN3-like protein, complete cds.600008956 (28)gb:AY248907_15926423e-12Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF043D22Sequence638007565 (27)gb:AB063192_15222064e-16Cucumis melo CmEIL2 mRNA for EIN3-like protein, complete cds.553008956 (28)gb:AY248907_15926423e-12Nicotiana tabacum EIL5 mRNA, complete cds.
JMFF044E03Sequence636007565 (27)gb:AB063192_15222061e-30Cucumis melo CmEIL2 mRNA for EIN3-like protein, complete cds.572008956 (28)gb:AY248907_15926426e-23Nicotiana tabacum EIL5 mRNA, complete cds.
JMFS089G03Sequence523007565 (27)gb:AF328786_17869139e-14Lycopersicon esculentum EIL3 (EIL3) mRNA, complete cds.
JMFS102E09Sequence627007565 (27)gb:AY248907_1592642e-109Nicotiana tabacum EIL5 mRNA, complete cds.
JMSF012J21Sequence264007565 (27)706008956 (28)gb:AY248907_15926421e-22Nicotiana tabacum EIL5 mRNA, complete cds.
JMSF014H13Sequence522007565 (27)gb:AB063192_15222066e-16Cucumis melo CmEIL2 mRNA for EIN3-like protein, complete cds.779008956 (28)gb:AY248907_15926424e-22Nicotiana tabacum EIL5 mRNA, complete cds.
JMSF023B11Sequence675007565 (27)gb:AF328786_17869133e-22Lycopersicon esculentum EIL3 (EIL3) mRNA, complete cds.775008956 (28)gb:AY248907_15926421e-22Nicotiana tabacum EIL5 mRNA, complete cds.
JMSF043J17Sequence737007565 (27)gb:AB063192_15222063e-35Cucumis melo CmEIL2 mRNA for EIN3-like protein, complete cds.760008956 (28)gb:AY248907_15926421e-22Nicotiana tabacum EIL5 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS102E09+ TGCCTAACGAGCTTGCGAATCTTGGCAATGTCAGGGGACAAGTGCTTAATCA
                      ____________________________________________________________
consensus TGCCTAACGAGCTTGCGAATCTTGGCAATGTCAGGGGACAAGTGCTTAATCA
 
. : . : . : . : . : . :
JMFS102E09+ CTGCAGTGAGAACGCCCACTTTCCATGCCTTTTTCAAATCATGAGGCTTTTTATAGGGCG
                      ____________________________________________________________
consensus CTGCAGTGAGAACGCCCACTTTCCATGCCTTTTTCAAATCATGAGGCTTTTTATAGGGCG
 
. : . : . : . : . : . :
JMFS102E09+ GTGACCCTTGATCCTTTGGCATTCCCAACTGGTCCCACCATTCCTCGTTACCCGAAGGCC
                      ____________________________________________________________
consensus GTGACCCTTGATCCTTTGGCATTCCCAACTGGTCCCACCATTCCTCGTTACCCGAAGGCC
 
. : . : . : . : . : . :
JMFS102E09+ ACCAAGGAGGAGCAACACCCTTTTCCAAAGGAAACCTTCTCTGAGGAGGATCACAGTGTT
                      ____________________________________________________________
consensus ACCAAGGAGGAGCAACACCCTTTTCCAAAGGAAACCTTCTCTGAGGAGGATCACAGTGTT
 
. : . : . : . : . : . :
JMFS102E09+ GCATCAGAGCAGATAACAGCGAGCCCAACGTCGTATCCTGGAGCTCTTGCAGCGTGTGAG
                      ____________________________________________________________
consensus GCATCAGAGCAGATAACAGCGAGCCCAACGTCGTATCCTGGAGCTCTTGCAGCGTGTGAG
 
. : . : . : . : . : . :
JMFS102E09+ GAGTTGACACCACCACACTCGACTCCTCAATCTTCCCCGGGATATTGTTTTCTGCCTGGT
                      ____________________________________________________________
consensus GAGTTGACACCACCACACTCGACTCCTCAATCTTCCCCGGGATATTGTTTTCTGCCTGGT
 
. : . : . : . : . : . :
JMFS102E09+ ACTTGGCAACTGCAGCTGGGCCATTTCGATCAAATCTGACCTTCTCCTTCCACCAAGCGC
JMSF043J17+ TCCTTCCACCAAGCGC
                      ____________________________________________________________
consensus ACTTGGCAACTGCAGCTGGGCCATTTCGATCAAATCTGACCTTCTCCTTCCACCAAGCGC
 
. : . : . : . : . : . :
JMFS102E09+ GAAGATTGTCAGAAGCTCCGCTCACGGGCTTCCCCTTCTCGGGAATAATCCCGTAAACAA
JMSF023B11+ CGGGAATAATCCNGTAAACAA
JMFF044E03+ AGATTGTCAGAAGCTCCGCTCACGGGCTTCCCCTTCTCGGGAATAATCCCGTAAACAA
JMFF043A15+ AGATTGTCAGAAGATCCGCTCACGGGCTTCCCCTTCTCGGGAATAATCCCGTAAACAA
JMSF043J17+ GAAGATTGTCAGAAGCTCCGCTCACGGGCTTCCCCTTCTCGGGAATAATCCCGTAAACAA
                      ____________________________________________________________
consensus GAAGATTGTCAGAAGCTCCGCTCACGGGCTTCCCCTTCTCGGGAATAATCCCGTAAACAA
 
. : . : . : . : . : . :
JMFS102E09+ AGCCCTGAGCATTGCAAACCTCCATCATCTTCAGCATGTACTTCAGTATACCGTCTTGAG
JMFF043D22+ TTGCAAACCTCCATCATCTTCAGCATGTACTTCAGTATACCGTCTGNAG
JMSF023B11+ AGCCCTGAGCATTGCAAACCTCCATCATCTTCAGCATGTACTTCAGTATACCGTCTTGAG
JMFF013G17+ ACCTCCATCATNTTCAGCATGTACTTCAGTATACCGTCTTGAG
JMFF010D03+ AACCTCCATCATCTTCAGCATGTACTTCAGTATACCGTCTTGAG
JMFF002A03+ TCCATCATCTTCAGCATGTACTTCAGTATACCGTCTNGAG
JMSF014H13+ CAAACCTCCATCATCTTCAGCATGTACTTCAGTATACCGTCTTGAG
JMFF044E03+ AGCCCTGAGCATTGCAAACCTCCATCATCTTCAGCATGTACTTCAGTATACCGTCTTGAG
JMFS089G03+ AGCCATGAGCATCGCAAACCTCCATCATATTCAGCATGTGATTCAGTATCCCGTCTTGAG
JMFF043A15+ AGCCCTGAGCATTGCAAACCTCCATCATCTTCAGCATGTACTTCAGTATACCGTCTTGAG
JMSF043J17+ AGCCCTGAGCATTGCAAACCTCCATCATCTTCAGCATGTACTTCAGTATACCGTCTTGAG
                      ____________________________________________________________
consensus AGCCCTGAGCATTGCAAACCTCCATCATCTTCAGCATGTACTTCAGTATACCGTCTTGAG
 
. : . : . : . : . : . :
JMFS102E09+ CACGGGACATCTTCTTCCTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
JMFF043D22+ CACGGGACATCTTCTTCCTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
JMSF023B11+ CACGGGACATCTTCTTCCTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
JMFF013G17+ CACGGGACATCTTCTTCCTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
JMFF010D03+ CACGGGACATCTTCTTCCTCCGTGCTTGCTCNTGGGACTGGCGATGCTTCGCGCTGTCAG
JMFF002A03+ CACGGGACATCTTCTTCCTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
JMSF014H13+ CACGGGACATCTTCTTCCTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
JMFF044E03+ CACGGGACATCTTCTTCCTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
JMFS089G03+ CACGGGACATCTTCTTCATCCGTGGTTGCTCCTGGGACTGGCCATGATTCGAGCTGTCAG
JMFF043A15+ CACGGGACATCTTCTTCCTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
JMFF028L10+ CTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
JMFF007O05+ CCTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
JMFF006D17+ TCCTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
JMSF043J17+ CACGGGACATCTTCTTCCTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
                      ____________________________________________________________
consensus CACGGGACATCTTCTTCCTCCGTGCTTGCTCCTGGGACTGGCGATGCTTCGCGCTGTCAG
 
. : . : . : . : . : . :
JMFS102E09+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGC
JMFF043D22+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMSF023B11+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF013G17+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF010D03+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF002A03+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMSF014H13+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF044E03+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFS089G03+ CTCCATCCTTGGTTCTGTTCATATACATCAGCCGCCTCAGCAGCATCATGTCCCTCAACA
JMFF043A15+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF039A16+ TCAACAGCATCCTGTCCCTCCACA
JMFF016D10+ TTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF028L10+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF030L07+ TCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF007O05+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF027L04+ TCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF036B12+ CTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF033I04+ GCCTCAACAGCATCCTGTCCCTCCACA
JMFF021P02+ TCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF003G13+ CTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF006D17+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
JMFF020A09+ TCAGCCGCCTCAACAGCATCCTGTCCNTCCACA
JMSF043J17+ CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
                      ____________________________________________________________
consensus CTCCATCCTTGGTTTTGTTCTTCTCCCTCAGCCGCCTCAACAGCATCCTGTCCCTCCACA
 
. : . : . : . : . : . :
JMFF043D22+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMSF023B11+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF013G17+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF010D03+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF002A03+ TCCTCCTCTCCAGCTCACTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMSF014H13+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF044E03+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFS089G03+ TCCTCCTATACAGCTC-CTTCACAGCCATGTCATCATCGATGTAGTCATCGTCCTCAACC
JMFF043A15+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF039A16+ TCCCCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF016D10+ TCCCCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF028L10+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF030L07+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF007O05+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF027L04+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF035B11+ CTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF036B12+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF033N01+ CCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF033I04+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCNCTGTAGTCATCGTCCTCAACC
JMFF021P02+ TCCTCCCCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGCCATCGTCCTCAACC
JMFF003G13+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF006D17+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMFF020A09+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
JMSF043J17+ TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
                      ____________________________________________________________
consensus TCCTCCTCTCCAGCTC-CTCCACATCCATGTCATCATCACTGTAGTCATCGTCCTCAACC
 
. : . : . : . : . : . :
JMFF043D22+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMSF023B11+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF013G17+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF010D03+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF002A03+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMSF014H13+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF044E03+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFS089G03+ CCAACCCCCGGGGCCATGGTTTCAACTTCAGGAGCCATTTCAGTACATCCCGGGGACTAC
JMFF043A15+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF039A16+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF016D10+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF028L10+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF030L07+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF007O05+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF027L04+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF035B11+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF036B12+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF033N01+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF033I04+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF021P02+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF003G13+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF006D17+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMFF020A09+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
JMSF043J17+ CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
                      ____________________________________________________________
consensus CCAACCCCCGGTGCCTTGGTTTCAACTTCAGGTGCCATTTCAGTACATCCCGGGGACTCC
 
. : . : . : . : . : . :
JMFF043D22+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMSF023B11+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF013G17+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF010D03+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF002A03+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMSF014H13+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF044E03+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFS089G03+ GAGAGGAAATCAAGATTCTCTCAAAAACCCATGTTCGCCATATCGTCAAACATACCCCTC
JMFF043A15+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF039A16+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF016D10+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF028L10+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF030L07+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF007O05+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF027L04+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF035B11+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF036B12+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF033N01+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF033I04+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF021P02+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMSF012J21+ TCCTCAAACATACCCATC
JMFF003G13+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF006D17+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMFF020A09+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
JMSF043J17+ GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
                      ____________________________________________________________
consensus GAGAGGAAATCAAGATTCTCACAAAAACCCATATTCGCCATATCCTCAAACATACCCATC
 
. : . : . : . : . : . :
JMFF043D22+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMSF023B11+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF013G17+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF010D03+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF002A03+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMSF014H13+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF030J24+ GTATCAAATCAAATCCCTAGCCAA
JMFF044E03+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFS089G03+ GACCAGATCCAAGCGAAATCTGCTCACCCAAGTTATGTATCAAATGAAATCCCTAGCCAA
JMFF043A15+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF039A16+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF016D10+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF028L10+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF030L07+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF007O05+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF027L04+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF035B11+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF036B12+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF033N01+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF033I04+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF021P02+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMSF012J21+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF003G13+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF006D17+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMFF020A09+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
JMSF043J17+ AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
                      ____________________________________________________________
consensus AACCAGATCCAAGCAAAATCTACACACACAACTTATGTATCAAATCAAATCCCTAGCCAA
 
. : . : . : . : . : . :
JMFF043D22+ GCCCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMSF023B11+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF013G17+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF010D03+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF002A03+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMSF014H13+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF030J24+ GCTGTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF044E03+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFS089G03+ GCTGTGATGATATTTCCACTGGAATTGATGCACTCAAGATCAAACAAAGGCCCAAGCTCT
JMFF043A15+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF039A16+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF016D10+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF028L10+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF030L07+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF007O05+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF027L04+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF035B11+ GCTCTGATGATTTTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF036B12+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF033N01+ GCCCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF033I04+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF021P02+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMSF012J21+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF003G13+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMFF006D17+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAAC-AAGACCAAAGCTCT
JMFF020A09+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
JMSF043J17+ GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
                      ____________________________________________________________
consensus GCTCTGATGATATTTACACTGGAATTGATGCACACAAGATCAAACAAAGACCAAAGCTCT
 
. : . : . : . : . : . :
JMFF043D22+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMSF023B11+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF013G17+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF010D03+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF002A03+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMSF014H13+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACT
JMFF030J24+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF044E03+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFS089G03+ CATCTTTGGATAGATCTTCCCCCCTCCAA
JMFF043A15+ CATCTTTGGATAGATCTTCCCCCCTCCAATGA---TGAGCCACTGACTGACAAACTGAGA
JMFF039A16+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF016D10+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF028L10+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF030L07+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF007O05+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF027L04+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF035B11+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF036B12+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF033N01+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF033I04+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF021P02+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAGCTGAGA
JMSF012J21+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF003G13+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF006D17+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMFF020A09+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
JMSF043J17+ CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
                      ____________________________________________________________
consensus CATCTTTGGATAGATCTTCCCCCCTCCAATGATTTTGAGCCACTGACTGACAAACTGAGA
 
. : . : . : . : . : . :
JMFF043D22+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
JMSF023B11+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
JMFF013G17+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCC
JMFF010D03+ AGTTCTATCTCCAAGAACCCTCTGTAATTCC
JMFF002A03+ AGTTCTATCTCCAAGAACCCTCTGTAGT
JMFF030J24+ AGTTCTATCTCCAAGAACCCTCTGTAATTCC
JMFF044E03+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTAT
JMFF043A15+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTAT
JMFF039A16+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
JMFF016D10+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
JMFF028L10+ AGTTCTATCTCCAAGAACCCTCTGTAATTCC
JMFF030L07+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAAC
JMFF007O05+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
JMFF027L04+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
JMFF035B11+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
JMFF036B12+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
JMFF033N01+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
JMFF033I04+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
JMFF021P02+ AGTTCTATCTCCAAGAACCCCCTGT
JMSF012J21+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
JMFF003G13+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
JMFF006D17+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTAT
JMFF020A09+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGA
JMSF043J17+ AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
                      ____________________________________________________________
consensus AGTTCTATCTCCAAGAACCCTCTGTAGTTCCGAATTATGGTTTGGGAAACAAAGATGATA
 
. : . : . : . : . : . :
JMFF043D22+ AGAACAAAAGGGGAGAGAAAGAAAGGGAGTTTGATGGCGTTGTTGCGTAG
JMSF023B11+ AGAACAAAAGGGGAGAGAAAGAAAGGGAGTTTGATGGCGTTGTTGCGTAGTGGT
JMFF039A16+ AGAACAAAAGGGGAGAGAAAGAAAGGGAGTTTGATGGCGTTGTTGCGTAGTGGT
JMFF016D10+ AGAACAAAAGGGGAGAGAAAGAAAGGGAGTTTGATGGCGTTGTTGCGTAGTGGT
JMFF007O05+ AGAACAAAAGGGGAGAGAAAGAAAGGGAGTTTGATGGCGTTGTTGCGTAGTGGTGAC
JMFF027L04+ AGAACAAAAGGGGAGAGAAAGAAAGGGAGTTTGATGGCGTTGTTGCGTAGTGGTGAC
JMFF035B11+ AGAACAAAAGGGGAGAGAAAGAAAGGGAGTTTGATGGCGTTGTTGCGTAGTGGTGAC
JMFF036B12+ AGAA
JMFF033N01+ AGAACAAAAGGGGAGAGAAAGAAAGGGAGTTTGATGGCGTTGTTGCGTAGTGGTGAC
JMFF033I04+ AGAA
JMSF012J21+ AGAAC
JMFF003G13+ AGAACAAAAGGGGAGAGAAAGAAAGGGAGTTTGATGGCGTTGTTGCGTAGTGGTGAC
JMSF043J17+ AGAACAAAAGGGGAGAGAAAGAAAGGGAGTTTGATGGCGTTGTTGCGTAGTGGTGACTCC
                      ____________________________________________________________
consensus AGAACAAAAGGGGAGAGAAAGAAAGGGAGTTTGATGGCGTTGTTGCGTAGTGGTGACTCC