Previous Contig 007562:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS103A01Sequence607007562 (3)gb:NTIPTVP31_16915924e-71N.tabacum mRNA for inorganic pyrophosphatase (TVP31 clone).
JMFS135D10Sequence613007562 (3)gb:NTIPTVP31_16915921e-72N.tabacum mRNA for inorganic pyrophosphatase (TVP31 clone).
JMSF043I24Sequence787007562 (3)gb:NTIPTVP31_1691592e-100N.tabacum mRNA for inorganic pyrophosphatase (TVP31 clone).694024041pir|S61423|S614234e-74inorganic diphosphatase (EC 3.6.1.1) (clone TVP9) - common tobacco

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043I24+ TCATTAC
                      ____________________________________________________________
consensus TCATTAC
 
. : . : . : . : . : . :
JMSF043I24+ CATAGTACAGCTTGAACAGATTGATGGTAATGTACAACACCAAAAGGCCATTCGCAGCAA
                      ____________________________________________________________
consensus CATAGTACAGCTTGAACAGATTGATGGTAATGTACAACACCAAAAGGCCATTCGCAGCAA
 
. : . : . : . : . : . :
JMSF043I24+ GAAGGAAACCCATCACCGCACCAGATCTAAATGCAATAATGAAAGCCTTCCCAACACCCT
                      ____________________________________________________________
consensus GAAGGAAACCCATCACCGCACCAGATCTAAATGCAATAATGAAAGCCTTCCCAACACCCT
 
. : . : . : . : . : . :
JMFS103A01+ AAGTTGCTATTTTCATTCCAAGANAAC
JMFS135D10+ GCATAAGTTGCTATTTTCATTCCAAGAAAAC
JMSF043I24+ TTCTAGCTTCCAAAGTTGTTCTGGCATTTGCATAAGTTGCTATTTTCATTCCAAGAAAAC
                      ____________________________________________________________
consensus TTCTAGCTTCCAAAGTTGTTCTGGCATTTGCATAAGTTGCTATTTTCATTCCAAGAAAAC
 
. : . : . : . : . : . :
JMFS103A01+ CAGAAACTACAGAAGTAACAGCACCAAGCAAGAAAGATATGGTGCTAAAGACAGCAGTAG
JMFS135D10+ CAGAAACTACAGAAGTAACAGCACCAAGCAAGAAAGATATGGTGCTAAAGACAGCAGTAG
JMSF043I24+ CAGAAACTACAGAAGTAACAGCACCAAGCAAGAAAGATATGGTGCTAAAGACAGCAGTAG
                      ____________________________________________________________
consensus CAGAAACTACAGAAGTAACAGCACCAAGCAAGAAAGATATGGTGCTAAAGACAGCAGTAG
 
. : . : . : . : . : . :
JMFS103A01+ CAAGAGCAGGCTTGCACAATTTGGTCTCATCATATGTGCAAGGCTGGCTCATTGTGCTGA
JMFS135D10+ CAAGAGCAGGCTTGCACAATTTGGTCTCATCATATGTGCAAGGCTGGCTCATTGTGCTGA
JMSF043I24+ CAAGAGCAGGCTTGCACAATTTGGTCTCATCATATGTGCAAGGCTGGCTCATTGTGCTGA
                      ____________________________________________________________
consensus CAAGAGCAGGCTTGCACAATTTGGTCTCATCATATGTGCAAGGCTGGCTCATTGTGCTGA
 
. : . : . : . : . : . :
JMFS103A01+ AACCTTCAACTGAGCCAAGAAATACGAAGATCAAAATAGCAAAAGCAACCATGAAAATAC
JMFS135D10+ AACCTTCAACTGAGCCAAGAAATACGAAGATCAAAATAGCAAAAGCAACCATGAAAATAC
JMSF043I24+ AACCTTCAACTGAGCCAAGAAATACGAAGATCAAAATAGCAAAAGCAACCATGAAAATAC
                      ____________________________________________________________
consensus AACCTTCAACTGAGCCAAGAAATACGAAGATCAAAATAGCAAAAGCAACCATGAAAATAC
 
. : . : . : . : . : . :
JMFS103A01+ CAACATATTGGTATTCAGTGAAAAGGAAAGAAGTTGCACCTTCGGAGATGGCGCTTTGGA
JMFS135D10+ CAACATATTGGTATTCAGTGAAAAGGAAAGAAGTTGCACCTTCGGAGATGGCGCTTTGGA
JMSF043I24+ CAACATATTGGTATTCAGTGAAAAGGAAAGAAGTTGCACCTTCGGAGATGGCGCTTTGGA
                      ____________________________________________________________
consensus CAACATATTGGTATTCAGTGAAAAGGAAAGAAGTTGCACCTTCGGAGATGGCGCTTTGGA
 
. : . : . : . : . : . :
JMFS103A01+ TTTCGGCGCACTTCTGAACGACGTTATGGTCATTAATGCCTTCCTCCTCCTCAATAAGCG
JMFS135D10+ TTTCGGCGCACTTCTGAACGACGTTATGGTCATTAATGCCTTCCTCCTCCTCAATAAGCG
JMSF043I24+ TTTCGGCGCACTTCTGAACGACGTTATGGTCATTAATGCCTTCCTCCTCCTCAATAAGCG
                      ____________________________________________________________
consensus TTTCGGCGCACTTCTGAACGACGTTATGGTCATTAATGCCTTCCTCCTCCTCAATAAGCG
 
. : . : . : . : . : . :
JMFS103A01+ ACTCAGCGAAGCCGTTCTTCGCGTCAGAGTCAGAGGCGGACTTCTCCGGCGAGAGCTTGA
JMFS135D10+ ACTCAGCGAAGCCGTTCTTCGCGTCAGAGTCAGAGGCGGACTTCTCCGGCGAGAGCTTGA
JMSF043I24+ ACTCAGCGAAGCCGTTCTTCGCGTCAGAGTCAGAGGCGGACTTCTCCGGCGAGAGCTTGA
                      ____________________________________________________________
consensus ACTCAGCGAAGCCGTTCTTCGCGTCAGAGTCAGAGGCGGACTTCTCCGGCGAGAGCTTGA
 
. : . : . : . : . : . :
JMFS103A01+ CCTTGGATACAAGGATCCACTGGACTAGCGCAAAGGCTATGCCGACTATGGCGCACACTG
JMFS135D10+ CCTTGGATACAAGGATCCACTGGACTAGCGCAAAGGCTATGCCGACTATGGCGCACACTG
JMSF043I24+ CCTTGGATACGAGGATCCACTGGACTAGCGCAAAGGCTATGCCGACTATGGCGCACACTG
                      ____________________________________________________________
consensus CCTTGGATACAAGGATCCACTGGACTAGCGCAAAGGCTATGCCGACTATGGCGCACACTG
 
. : . : . : . : . : . :
JMFS103A01+ GAATCAGTATCTCCGTCCCGAGATCTGGCAGAAT
JMFS135D10+ GAATCAGTATCTCCGTCCCGAGATCTGGCAGAAT
JMSF043I24+ GAATCAGTATCTCCGTCCCGAGATCTGGCAGAATAGTCGAAGCACCCATGGCCGTCGCCT
                      ____________________________________________________________
consensus GAATCAGTATCTCCGTCCCGAGATCTGGCAGAATAGTCGAAGCACCCATGGCCGTCGCCT
 
. : . : . : . : . : . :
JMSF043I24+ CTGCCGGAAAACCGAGCTGCGGAGGCGGGGGTCGAAGAAAGTGGGAGAAGAAATGGGAGA
                      ____________________________________________________________
consensus CTGCCGGAAAACCGAGCTGCGGAGGCGGGGGTCGAAGAAAGTGGGAGAAGAAATGGGAGA
 
. : . : . : . : . : . :
JMSF043I24+ ACGGAGGACGAAATAGGAAGGCGACGTCTGCGGTGGTTTACACTCTTCTTGGAGATTATC
                      ____________________________________________________________
consensus ACGGAGGACGAAATAGGAAGGCGACGTCTGCGGTGGTTTACACTCTTCTTGGAGATTATC