Previous Contig 007560:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003H08Sequence586007560 (18)gb:AY054493_15631473e-53Arabidopsis thaliana Unknown protein (At5g42570; K16E1.4) mRNA, complete cds.
JMFF033G18Sequence110007560 (18)562007560 (18)gb:AY085524_15705937e-53Arabidopsis thaliana clone 1558 mRNA, complete sequence.
JMFF046P18Sequence454007560 (18)gb:AY085524_15705933e-34Arabidopsis thaliana clone 1558 mRNA, complete sequence.466007560 (18)gb:AY054493_15631472e-18Arabidopsis thaliana Unknown protein (At5g42570; K16E1.4) mRNA, complete cds.
JMFN009D04Sequence596007560 (18)gb:AY085524_15705938e-43Arabidopsis thaliana clone 1558 mRNA, complete sequence.
JMFN011L01Sequence640007560 (18)gb:AY085524_15705933e-47Arabidopsis thaliana clone 1558 mRNA, complete sequence.
JMSF014D11Sequence109007560 (18)568007560 (18)gb:AY054493_15631471e-57Arabidopsis thaliana Unknown protein (At5g42570; K16E1.4) mRNA, complete cds.
JMSF024G24Sequence118007560 (18)583007560 (18)gb:AY054493_15631476e-53Arabidopsis thaliana Unknown protein (At5g42570; K16E1.4) mRNA, complete cds.
JMSF026G24Sequence119007560 (18)
JMSF040B14Sequence109007560 (18)782007560 (18)gb:AY054493_15631474e-56Arabidopsis thaliana Unknown protein (At5g42570; K16E1.4) mRNA, complete cds.
JMSF043I14Sequence173007560 (18)510007560 (18)gb:AY085524_15705933e-52Arabidopsis thaliana clone 1558 mRNA, complete sequence.
JMSF048J23Sequence173007560 (18)674007560 (18)gb:AY054493_15631477e-35Arabidopsis thaliana Unknown protein (At5g42570; K16E1.4) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF048J23- GATGCTGGTTTTATGCCAATGTTCATTAACNAGGGANTCAAGGANGGNATTTT
                      ____________________________________________________________
consensus GATGCTGGTTTTATGCCAATGTTCATTAACNAGGGANTCAAGGANGGNATTTT
 
. : . : . : . : . : . :
rJMSF048J23- GTATGGNTTTGTTTGANGCCAACTGCTTAACATAACNTAATTNGGGGAACTATGAACTAT
                      ____________________________________________________________
consensus GTATGGNTTTGTTTGANGCCAACTGCTTAACATAACNTAATTNGGGGAACTATGAACTAT
 
. : . : . : . : . : . :
rJMFF046P18- AGATCCAAAACTCATAAACATACATACAATCAC
rJMSF048J23- CGTTGATGATGTTATCATAACCTGAGAAGATCCAAAACTCATNANCATNCATACANACAC
rJMSF040B14- CAC
                      ____________________________________________________________
consensus CGTTGATGATGTTATCATAACCTGAGAAGATCCAAAACTCATAAACATACATACAATCAC
 
. : . : . : . : . : . :
rJMFF046P18- AGATAACATGGGGACGTGTGTTCATAATCAACCAGGAAATATAAAGACAAGTTTTGGTCT
rJMSF048J23- AGATAACATGGGGACGTGTGTTCATAATCAACCAGGAAATATAAAGACAAGTTTTGGTCT
rJMSF040B14- AGATAACATGGGGACGTGTGTTCATAANCAACCAGGAAATATAAAGACAAGTTTTGGTCT
                      ____________________________________________________________
consensus AGATAACATGGGGACGTGTGTTCATAATCAACCAGGAAATATAAAGACAAGTTTTGGTCT
 
. : . : . : . : . : . :
rJMFF046P18- GAACATAAAACGATATCAAAACTATTAATCGTTTGCTCCTCGTTCGCCTACTAAGTATTC
rJMSF048J23- GAACATAAAACGATATCAAAACTATTAATCGTTTGCTCCTCGTTCGCCTACTAAGTATTC
rJMSF040B14- GAACATAANACGATATCAAAACTATTAATCGNTTGCTCCTCGTTCGCCTACTAAGTATTC
                      ____________________________________________________________
consensus GAACATAAAACGATATCAAAACTATTAATCGTTTGCTCCTCGTTCGCCTACTAAGTATTC
 
. : . : . : . : . : . :
rJMFF046P18- TTCTTGCCATTTGAATGGGATAAGTTTTCGTCGAGTGCATGAAGTTGGCTTCGAAGATGT
rJMSF048J23- TTCTTGCCATTTGAATGGGATAAGTTTTCGTCGAGTGCATGAAGTTGGCTTCGAAGATGT
rJMFF003H08- TGCATGAAGTTGGCTTCGAAGATGT
rJMSF024G24- GAAGATGT
rJMSF014D11- AGTTTTCGTCGAGTGCATGAAGTTGGCTTCGAAGATGT
rJMSF040B14- TTCTTGCCNTTTGAATGGGATAAGTTTTCGTCGAGTGCATGAAGTTGGCTTCGAAGATGT
                      ____________________________________________________________
consensus TTCTTGCCATTTGAATGGGATAAGTTTTCGTCGAGTGCATGAAGTTGGCTTCGAAGATGT
 
. : . : . : . : . : . :
rJMFF046P18- TGATTCTCCTCCAGCAACTGGCCATATTCGAGTAGCAGTTTTTCGGACTGACCTTTAAAG
rJMSF048J23- TGATTCTCCTCCAGCAACTGGCCATATTCGAGTAGCAGTTTTTCGGACTGACCTTTAAAG
rJMSF043I14- ATATTCGAGTANCAGTNTTTCGGACTGACCATTAAAG
rJMFF003H08- TGATTCTCCTCCAGCAACTGGCCATATTCGAGTAGCAGTTTTTCGGACTGACCTTTAAAG
rJMFF033G18- TCCAGCAACTGGCCATATTCGAGTAGCAGTTTTTCGGACTGACCTTTAAAG
rJMSF024G24- TGATTCTCCTCCAGCAACTGGCCATATTCGAGTAGCAGTTTTTCGGACTGACCTTTAAAG
rJMSF014D11- TGATTCTCCTCCAGCAACTGGCCATATTCGAGTAGCAGTTTTTCGGACTGACCTTTAAAG
rJMSF040B14- TGATTCTCCTCCAGCAACTGGCCATATTCGAGTAGCAGTTTTTCGGACTGACCTTTAAAG
JMFN011L01+ CGGACTGACCTTTAAAG
                      ____________________________________________________________
consensus TGATTCTCCTCCAGCAACTGGCCATATTCGAGTAGCAGTTTTTCGGACTGACCTTTAAAG
 
. : . : . : . : . : . :
rJMFF046P18- GACTCGGAGTTGTCTTTCTGAGCTTTCACCTCTTCCCCTTTTGCTTCGCATTCTGATTCC
rJMSF048J23- GACTCGGAGTTGTCTTTCTGAGCTTTCACCTCTTCCCCTTTTGCTTCGCATTCTGATTCC
rJMSF043I14- GACTCGGAGTTGTCTTTCTGAGCTTTCACCTCTTCCCCTTTTGCTTCGCATTCTGATTCC
rJMFF003H08- GACTCGGAGTTGTCTTTCTGAGCTTTCACCTCTTCCCCTTTTGCTTCGCATTCTGATTCC
rJMFF033G18- GACTCGGAGTTGTCTTTCTGAGCTTTCACCTCTTCCCCTTTTGCTTCGCATTCTGATTCC
rJMSF024G24- GACTCGGAGTTGTCTTTCTGAGCTTTCACCTCTTCCCCTTTTGCTTCGCATTCTGATTCC
rJMSF014D11- GACTCGGAGTTGTCTTTCTGAGCTTTCACCTCTTCCCCTTTTGCTTCGCATTCTGATTCC
rJMSF040B14- GACTCGGAGTTGTCTTTCTGAGCTTTCACCTCTTCCCCTTTTGCTTCGCATTCTGATTCC
JMFN011L01+ GACTCGGAGTTGTCTTTCTGAGCTTTCACCTCTTCCCCTTNTGCTTCGCATTCTGATTCC
JMFN009D04+ GATTCC
                      ____________________________________________________________
consensus GACTCGGAGTTGTCTTTCTGAGCTTTCACCTCTTCCCCTTTTGCTTCGCATTCTGATTCC
 
. : . : . : . : . : . :
rJMFF046P18- AGCTTCTTTATCTTGGACTTCATTGAGGCGATCTCCTCTTTTAGGGAATTGACCTCCTCC
rJMSF048J23- AGCTTCTTTATCTTGGACTTCATTGAGGCGATCTCCTCTTTTAGGGAATTGACCTCCTCC
rJMSF043I14- AGCTTCTTTATCTTGGACTTCATTGAGGCGATCTCCTCTTTTAGGGAATTGACCTCCTCC
rJMFF003H08- AGCTTCTTTATCTTGGACTTCATTGAGGCGATCTCCTCTTTTAGGGAATTGACCTCCTCC
rJMFF033G18- AGCTTCTTTATCTTGGACTTCATTGAGGCGATCTCCTCTTTTAGGGAATTGACCTCCTCC
rJMSF024G24- AGCTTCTTTATCTTGGACTTCATTGAGGCGATCTCCTCTTTTAGGGAATTGACCTCCTCC
rJMSF014D11- AGCTTCTTTATCTTGGACTTCATTGAGGCGATCTCCTCTTTTAGGGAATTGACCTCCTCC
rJMSF040B14- AGCTTCTTTATCTTGGACTTCATTGAGGCGATCTCCTCTTTTAGGGAATTGACCTCCTCC
JMFN011L01+ AGCTTCTTTATCTTGGACTTCATTGAGGCGATCTCCTCTTNTAGGGAATTGACCTCCTCC
JMFN009D04+ AGCTTCTTTATCTTGGACTTCATTGAGGCGATCTCCTCTTTTAGGGAATTGACCTCCTCC
                      ____________________________________________________________
consensus AGCTTCTTTATCTTGGACTTCATTGAGGCGATCTCCTCTTTTAGGGAATTGACCTCCTCC
 
. : . : . : . : . : . :
rJMFF046P18- ACACCGCCATTCTTGCCATTATCAAAACCTCGATCGTGTTTCTTTGCAG
rJMSF048J23- ACACCGCCATTCTTGCCATTATCAAAACCTCGATCGTGTTTCTTTGCAGCCTCCATGGCC
rJMSF043I14- ACACCGCCATTCTTGCCATTATCAAAACCTCGATCGTGTTTCTTTGCAGCCTCCATGGCC
rJMFF003H08- ACACCGCCATTCTTGCCATTATCAAAACCTCGATCGTGTTTCTTTGCAGCCTCCATGGCC
rJMFF033G18- ACACCGCCATTCTTGCCATTATCAAAACCTCGATCGTGTTTCTTTGCAGCCTCCATGGCC
rJMSF024G24- ACACCGCCATTCTTGCCATTATCAAAACCTCGATCGTGTTTCTTTGCAGCCTCCATGGCC
rJMSF014D11- ACACCGCCATTCTTGCCATTATCAAAACCTCGATCGTGTTTCTTTGCAGCCTCCATGGCC
rJMSF040B14- ACACCGCCATTCTTGCCATTATCAAAACCTCGATCGTGTTTCTTTGCAGCCTCCATGGCC
JMFN011L01+ ACACCGCCATTCTTGCCATTATCAAAACCTCGATCGTGTTTCTTTGCAGCCTCCATGGCC
JMFF046P18+ TTATCAAAACCTCGATCGTGTTTCTTGNCAGCCTCCATGGCC
JMFN009D04+ ACACCGCCATTCTTGCCATTATCAAAACCTCGATCGTGTTTCTTTGCAGCCTCCATGGCC
                      ____________________________________________________________
consensus ACACCGCCATTCTTGCCATTATCAAAACCTCGATCGTGTTTCTTTGCAGCCTCCATGGCC
 
. : . : . : . : . : . :
rJMSF048J23- TTCCTGAGCAAGCGGAGCTCTCTTATGTAGTGATGCAGCCTGTCTATCATCAGCGAAAGA
rJMSF043I14- TTCCTGAGCAAGCGGAGCTCTCTTATGTAGTGATGCAGCCTGTCTATCATCAGCGAAAGA
rJMFF003H08- TTCCTGAGCAAGCGGAGCTCTCTTATGTAGTGATGCAGCCTGTCTATCATCAGCGAAAGA
rJMFF033G18- TTCCTGAGCAAGCGGAGCTCTCTTATGTAGTGATGCAGCCTGTCTATCATCAGCGAAAGA
rJMSF024G24- TTCCTGAGCAAGCGGAGCTCTCTTATGTAGTGATGCAGCCTGTCTATCATCAGCGAAAGA
rJMSF014D11- TTCCTGAGCAAGCGGAGCTCTCTTATGTAGTGATGCAGCCTGTCTATCATCAGCGAAAGA
rJMSF040B14- TTCCTGAGCAAGCGGAGCTCTCTTATGTAGTGATGCAGCCTGTCTATCATCAGCGAAAGA
JMFN011L01+ TTCCTGAGCAAGCGGAGCTCTCTTATGTAGTGATGCAGCCTGTCTATCATCAGCGAAAGA
JMFF046P18+ TTCCTGAGCAAGCGGAGCTCTCTTATGTAGTGATGCAGCCTGTCTATCATCAGCGAAAGA
JMFN009D04+ TTCCTGAGCAAGCGGAGCTCTCTTATGTAGTGATGCAGCCTGTCTATCATCAGCGAAAGA
                      ____________________________________________________________
consensus TTCCTGAGCAAGCGGAGCTCTCTTATGTAGTGATGCAGCCTGTCTATCATCAGCGAAAGA
 
. : . : . : . : . : . :
rJMSF048J23- AAGAGTACAAACCCCATGAGG
rJMSF043I14- AAGAGTACAAACCCCATGAGGGAGGCTTGAAGGATTTGCTGGGCAAGGAGGACCTGATCG
rJMFF003H08- AAGAGTACAAACCCCATGAGGGAGGCTTGAAGGATTTGCTGGGCAAGGAGGACCTGATCG
rJMFF033G18- AAGAGTACAAACCCCATGAGGGAGGCTTGAAGGATTTGCTGGGCAAGGAGGACCTGATCG
rJMSF024G24- AAGAGTACAAACCCCATGAGGGAGGCTTGAAGGATTTGCTGGGCAAGGAGGACCTGATCG
rJMSF014D11- AAGAGTACAAACCCCATGAGGGAGGCTTGAAGGATTTGCTGGGCAAGGAGGACCTGATCG
rJMSF040B14- AAGAGTACAAACCCCATGAGGGAGGCTTGAAGGATTTGCTGGGCAAGGAGGACCTGATCG
JMFN011L01+ AAGAGTACAAACCCCATGAGGGAGGCTTGAAGGATTTGCTGGGCAAGGAGGACCTGATCG
JMFF046P18+ AAGAGTACAAACCCCATGAGGGAGGCTTGAAGGATTTGCTGGGCAAGGAGGACCTGATCG
JMFN009D04+ AAGAGTACAAACCCCATGAGGGAGGCTTGAAGGATTTGCTGGGCAAGGAGGACCTGATCG
                      ____________________________________________________________
consensus AAGAGTACAAACCCCATGAGGGAGGCTTGAAGGATTTGCTGGGCAAGGAGGACCTGATCG
 
. : . : . : . : . : . :
rJMSF043I14- GTGGGATTGATGCTTTCGAGTGGTCGCGACTGGATTTCTTGGACGGAGTAGACGGTGTAG
rJMFF003H08- GTGGGATTGATGCTTTCGAGTGGTCGCGACTGGATTTCTTGGACGGAGTAGACGGTGTAG
rJMFF033G18- GTGGGATTGATGCTTTCGAGTGGTCGCGACTGGATTTCTTGGACGGAGTAGACGGTGTAG
rJMSF024G24- GTGGGATTGATGCTTTCGAGTGGTCGCGACTGGATTTCTTGGACGGAGTAGACGGTGTAG
rJMSF014D11- GTGGGATTGATGCTTTCGAGTGGTCGCGACTGGATTTCTTGGACGGAGTAGACGGTGTAG
rJMSF040B14- GTGGGATTGATGCTTTCGAGTGGTCGCGACTGGATTTCTTGGACGGAGTAGACGGTGTAG
JMFN011L01+ GTGGGATTGATGCTTTCGAGTGGTCGCGACTGGATTTCTTGGACGGAGTAGACGGTGTAG
JMFF046P18+ GTGGGATTGATGCTTTCGAGTGGTCGCGACTGGATTTCTTGGACGGAGTAGACGGTGTAG
JMFN009D04+ GTGGGATTGATGCTTTCGAGTGGTCGCGACTGGATTTCTTGGACGGAGTAGACGGTGTAG
                      ____________________________________________________________
consensus GTGGGATTGATGCTTTCGAGTGGTCGCGACTGGATTTCTTGGACGGAGTAGACGGTGTAG
 
. : . : . : . : . : . :
rJMSF043I14- ATCATGAGCACAAAGACGGTGGCGGCGACGGACTTCACTACGAGCGGGCCGCGGCCGCGC
rJMFF003H08- ATCATGAGCACAAAGACGGTGGCGGCGACGGACTTCACTACGAGCGGGCCGCGGCCGCGC
rJMFF033G18- ATCATGAGCACAAAGACGGTGGCGGCGACGGACTTCACTACGAGCGGGCCGCGGCCGCGC
rJMSF024G24- ATCATGAGCACAAAGACGGTGGCGGCGACGGACTTCACTACGAGCGGGCCGCGGCCGCGC
rJMSF014D11- ATCATGAGCACAAAGACGGTGGCGGCGACGGACTTCACTACGAGCGGGCCGCGGCCGCGC
rJMSF040B14- ATCATGAGCACAAAGACGGTGGCGGCGACGGACTTCACTACGAGCGGGCCGCGGCCGCGC
JMFN011L01+ ATCATGAGCACAAAGACGGTGGCGGCGACGGACTTCACTACGAGCGGGCCGCGGCCGCGC
JMFF046P18+ ATCATGAGCACAAAGACGGTGGCGGCGACGGACTTCACTACGAGCGGGCCGCGGCCGCGC
JMFN009D04+ ATCATGAGCACAAAGACGGTGGCGGCGACGGACTTCACTACGAGCGGGCCGCGGCCGCGC
                      ____________________________________________________________
consensus ATCATGAGCACAAAGACGGTGGCGGCGACGGACTTCACTACGAGCGGGCCGCGGCCGCGC
 
. : . : . : . : . : . :
rJMSF043I14- TTGGCCCGGTCCAGGCTGATAATCAGCAGCTTCCGCAACGGCGTCTT-GAAGAG
rJMFF003H08- TTGGCCCGGTCCAGGCTGATAATCAGCAGCTTCCGCAACGGCGTCTT-GAAGAGGAGCAG
rJMFF033G18- TTGGCCCGGTCCAGGCTGATAATCAGCAGCTTCCGCAACGGCGTCTTGGAAGANGAGCAG
rJMSF024G24- TTGGCCCGGTCCAGGCTGATAATCAGCAGCTTCCGCAACGGCGTCTT-GAAGAGGAGCAG
rJMSF014D11- TTGGCCCGGTCCAGGCTGATAATCAGCAGCTTCCGCAACGGCGTCTT-GAA
rJMSF040B14- TTGGCCCGGTCCAGGCTGATAATCAGCAGCTTCCGCAACGGCGTCTT-GAAGAGGAGCAG
JMFN011L01+ TTGGCCCGGTCCAGGCTGATAATCAGCAGCTTCCGCAACGGCGTCTT-GAAGAGGAGCAG
JMFF046P18+ TTGGCCCGGTCCAGGCTGATAATCAGCAGCTTCCGCAACGGCGTCTT-GAAGAGGAGCAG
JMFN009D04+ TTGGCCCGGTCCAGGCTGATAATCAGCAGCTTCCGCAACGGCGTCTT-GAAGAGGAGCAG
                      ____________________________________________________________
consensus TTGGCCCGGTCCAGGCTGATAATCAGCAGCTTCCGCAACGGCGTCTT-GAAGAGGAGCAG
 
. : . : . : . : . : . :
rJMFF003H08- TAGTATCACCGCCATCTCCCC
rJMFF033G18- TAGTATCACCGCCATCTCCCCGA
rJMSF024G24- TAGTATCACCGCCATCTCCCCGAACGCCACCGTGA
rJMSF040B14- TAGTATCACCGCCATCTCCCCGAACGCCACCGNGAATAGCAGCTGC
JMFN011L01+ TAGTATCACCGCCATCTCCCCGAACGCCACCGTGAATAGCAGCTGCGCTTGCGCCAA-CA
JMFF046P18+ TAGTATCACCGCCATCTCCCCGAACGCCACCGTGAATAGCAGCTGCGCTTGCGCCAACCA
JMFN009D04+ TAGTATCACCGCCATCTCCCCGAACGCCACCGTGAATAGCAGCTGCGCTTGCGCCAA-CA
                      ____________________________________________________________
consensus TAGTATCACCGCCATCTCCCCGAACGCCACCGTGAATAGCAGCTGCGCTTGCGCCAA-CA
 
. : . : . : . : . : . :
JMFN011L01+ TTTTTTTTTTTTTTT-TCAGATTCTTGGAATCAAAGTGCCGCTCTCTTAAATCAAAGATT
JMFF046P18+ TTTTTTTTTTTTTTTTTCAGATTCTTGGAATCAAAGTGCCGCTCTCTTAAATC
JMFN009D04+ TTTTTTTTTTTTTTTTTCAGATTCTTGGAATCAAAGTGCCGCTCTCTTAAATCAAAGATT
JMFF033G18+ TTTTTTTTTCTCAGATTCTTGGAATCAAAGTGCCGCTCTCTTAAATCAAAGATT
JMSF014D11+ TTTTTTTTTTCAGATTCTTGGAATCAAAGTGCCGCTCTCTTAAATCAAAGATT
JMSF026G24+ TTTTTTTTTTTCAGATTCTNGGAATCAAAGTGCCGCTCTCTTAAATCAAAGATT
JMSF040B14+ TTTTTTTTTTCAGATTCTTGGAATCAAAGTGCCGCTCTCTTAAATCAAAGATT
JMSF024G24+ TTTTTTTTTTCAGATTCTTGGAATCAAAGTGCCGCTCTCTTAAATCAAAGATT
JMSF048J23+ TTTTTTTTTTCAGATTCTTGGAATCAAAGTGCCGCTCTCTTAAATCAAAGATT
JMSF043I14+ TTTTTTTTTTCAGATTCTTGGAATCAAAGTGCCGCTCTCTTAAATCAAAGATT
                      ____________________________________________________________
consensus TTTTTTTTTTTTTTTTTCAGATTCTTGGAATCAAAGTGCCGCTCTCTTAAATCAAAGATT
 
. : . : . : . : . : . :
JMFN011L01+ CAACTGGAGAGGAAACTATAAATTAA
JMFN009D04+ CAACTGGAGAGGAAACTATAAATTAAATCAAAATTCACACAAATAAAAGAAA
JMFF033G18+ CAACTGGAGAGGAAACTATAAATTAAATCAAAATTCACACAAATAAAAGAAAGAT
JMSF014D11+ CAACTGGAGAGGAAACTATAAATTAAATCAAAATTCACACAAATAAAAGAAAGAT
JMSF026G24+ CAACTGGAGAGGAAACTATAAATTAAATCAAAATTCACACAAATAAAAGAAAGATGAGGA
JMSF040B14+ CAACTGGAGAGGAAACTATAAATTAAATCAAAATTCACACAAATAAAAGAAAGAT
JMSF024G24+ CAACTGGAGAGGAAACTATAAATTAAATCAAAATTCACACAAATAAAAGAAAGATGAGGA
JMSF048J23+ CAACTGGAGAGGAAACTATAAATTAAATCAAAATTCACACAAATAAAAGAAAGATGAGGA
JMSF043I14+ CAACTGGAGAGGAAACTATAAATTAAATCAAAATTCACACAAATAAAAGAAAGATGAGGA
                      ____________________________________________________________
consensus CAACTGGAGAGGAAACTATAAATTAAATCAAAATTCACACAAATAAAAGAAAGATGAGGA
 
. : . : . : . : . : . :
JMSF026G24+ TTTC
JMSF024G24+ TTTC
JMSF048J23+ TTTCGACGTTTGATTTTAGGATTTCTAGGAGCAGTTGAGCGCCGTGGTATTACCGTG
JMSF043I14+ TTTCGACGTTTGATTTTAGGATTTCTAGGAGCAGTTGAGCGCCGTGGTATTACCGTGCTC
                      ____________________________________________________________
consensus TTTCGACGTTTGATTTTAGGATTTCTAGGAGCAGTTGAGCGCCGTGGTATTACCGTGCTC