Previous Contig 007550:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007B08Sequence252007550 (6)gb:AP005285_18498453e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10545011975 (7)gb:AB012248_15118401e-57Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXI22.
JMSF001D06Sequence301007550 (6)gb:AP005285_18498451e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10788011975 (7)gb:AB012248_15118403e-79Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXI22.
JMSF001F02Sequence426007550 (6)gb:AB012248_15118401e-09Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXI22.782011975 (7)gb:AB012248_15118404e-77Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXI22.
JMSF005J22Sequence262007550 (6)gb:AP005285_18498453e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10256011975 (7)gb:AP005285_18498459e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMSF017K19Sequence410007550 (6)gb:AB012248_15118401e-16Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXI22.762011975 (7)gb:AB012248_15118405e-75Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXI22.
JMSF043G13Sequence763007550 (6)gb:AB012248_15118401e-23Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXI22.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043G13+ CTTTCAGGTCAACAGTAGCATCAGGATTGATTAAATCGAGGGAC
                      ____________________________________________________________
consensus CTTTCAGGTCAACAGTAGCATCAGGATTGATTAAATCGAGGGAC
 
. : . : . : . : . : . :
JMSF043G13+ AATTCAATACCTCCGAGGCTGGGCCCCCTCAAGTGATTGTACCTCCCACTGCTGCCGTCC
                      ____________________________________________________________
consensus AATTCAATACCTCCGAGGCTGGGCCCCCTCAAGTGATTGTACCTCCCACTGCTGCCGTCC
 
. : . : . : . : . : . :
JMSF043G13+ TCCTGACCTTCAGAAACAGTGCCAGTCTCGAAATCAGGAATTTCAGAAGCAGAGGCAGAC
                      ____________________________________________________________
consensus TCCTGACCTTCAGAAACAGTGCCAGTCTCGAAATCAGGAATTTCAGAAGCAGAGGCAGAC
 
. : . : . : . : . : . :
JMSF017K19+ AGGAGGAGTTGTGGAGGCGTTCGGAGTCGAGGGGGATAGTG
JMSF043G13+ ATCGAGGAGCGGCGGAGGAAGGAGGAGTTGTGGAGGCGTTCGGAGTCGAGGGGGATAGTG
                      ____________________________________________________________
consensus ATCGAGGAGCGGCGGAGGAAGGAGGAGTTGTGGAGGCGTTCGGAGTCGAGGGGGATAGTG
 
. : . : . : . : . : . :
JMSF001F02+ GAGGATGTGACGGAACTCTTCCTCGAGGTGTGCCATGNCAAGCTGAAGAGCA
JMSF017K19+ CTCCGAATGAGGATGTGACGGAACTCTTCCTCGAGGTGTGCCATGGCAAGCTGAAGAGCA
JMSF043G13+ CTCCGAATGAGGATGTGACGGAACTCTTCCTCGAGGTGTGCCATGGCAAGCTGAAGAGCA
                      ____________________________________________________________
consensus CTCCGAATGAGGATGTGACGGAACTCTTCCTCGAGGTGTGCCATGGCAAGCTGAAGAGCA
 
. : . : . : . : . : . :
JMSF001F02+ GCCTCCGCTCGGTCCATAACGGCATCGGCGTTGTCCGGCGGTAGATCCAGATCCTCGGTC
JMSF017K19+ GCCTCCGCTCGGTCCATAACGGCATCGGCGTTGTCCGGCGGTAGATCCAGATCCTCGGTC
JMSF043G13+ GCCTCCGCTCGGTCCATAACGGCATCGGCGTTGTCCGGCGGTAGATCCAGATCCTCGGTC
                      ____________________________________________________________
consensus GCCTCCGCTCGGTCCATAACGGCATCGGCGTTGTCCGGCGGTAGATCCAGATCCTCGGTC
 
. : . : . : . : . : . :
JMSF001F02+ AACCGAATAATCTCGTCAACGGCAGCGAGGTAGACTTCGGAGGAAGGGGGATCGCCGACG
JMSF017K19+ AACCGAATAATCTCGTCAACGGCAGCGAGGTAGACTTCGGAGGAAGGGGGATCGCCGACG
JMSF001D06+ CGTCAACGGCAGCGAGGTAGACTTCGGAGGAAGGGGGATCGCCGACG
JMSF043G13+ AACCGAATAATCTCGTCAACGGCAGCGAGGTAGACTTCGGAGGAAGGGGGATCGCCGACG
                      ____________________________________________________________
consensus AACCGAATAATCTCGTCAACGGCAGCGAGGTAGACTTCGGAGGAAGGGGGATCGCCGACG
 
. : . : . : . : . : . :
JMSF001F02+ CCGCCGTCCAGGATAAGCTTCTCAGCCTCCTCGAAGCGACGATCGAGAAAGGAATCGTCG
JMSF017K19+ CCGCCGTCCAGGATAAGCTTCTCAGCCTCCTCGAAGCGACGATCGAGAAAGGAATCGTCG
JMSF001D06+ CCGCCGTCCAGGATAAGCTTCTCAGCCTCCTCGAAGCGACGATCGAGAAAGGAATCGTCG
JMSF005J22+ CTCGAAGCGACGATCGAGAAAGGAATCGTCG
JMFF007B08+ GAGAAAGGAATCGTCG
JMSF043G13+ CCGCCGTCCAGGATAAGCTTCTCAGCCTCCTCGAAGCGACGATCGAGAAAGGAATCGTCG
                      ____________________________________________________________
consensus CCGCCGTCCAGGATAAGCTTCTCAGCCTCCTCGAAGCGACGATCGAGAAAGGAATCGTCG
 
. : . : . : . : . : . :
JMSF001F02+ TCTCCCGCGGCGGCGGCGGCAGCTTTGGCGGACGAAGGAGTAG-AGGTTGCGGAAGAAGA
JMSF017K19+ TCTCCCGCGGCGGCGGCGGCAGCTTTGGCGGACGAAGGAGTAG-AGGTTGCGGAAGAAGA
JMSF001D06+ TCTCCCGCGGCGGCGGCGGCAGCTTTGGCGGACGAAGGAGTAG-AGGTTGCGGAAGAAGA
JMSF005J22+ TCTCCCGCGGCGGCGGCGGCAGCTTTGGCGGACGAAGGAGTAG-AGGTTGCGGAAGAAGA
JMFF007B08+ TCTCCCGCGGCGGCGGCGGCAGCTTTGGCGGACGAAGGAGTAGNAGGTTGCGGAAGAAGA
JMSF043G13+ TCTCCCGCGGCGGCGGCGGCAGCTTTGGCGGACGAAGGAGTAG-AGGTTGCGGAAGAAGA
                      ____________________________________________________________
consensus TCTCCCGCGGCGGCGGCGGCAGCTTTGGCGGACGAAGGAGTAG-AGGTTGCGGAAGAAGA
 
. : . : . : . : . : . :
JMSF001F02+ AGCCATGAAATTGGAGAGGTTGGAGAGGCGATTGTCGAAGCTGGAGAAGATGAGAAGCAT
JMSF017K19+ AGCCATGAAATTGGAGAGGTTGGAGAGGCGATTGTCGAAGCTGGAGAAGATGAGAAGCAT
JMSF001D06+ AGCCATGAAATTGGAGAGGTTGGAGAGGCGATTGTCGAAGCTGGAGAAGATGAGAAGCAT
JMSF005J22+ AGCCATGAAATTGGAGAGGTTGGAGAGGCGATTGTCGAAGCTGGAGAAGATGAGAAGCAT
JMFF007B08+ AGCCATGAAATTGGAGAGGTTGGAGAGGCGATTGTCGAAGCTGGAGAAGATGAGAAGCAT
JMSF043G13+ AGCCATGAAATTGGAGAGGTTGGAGAGGCGATTGTCGAAGCTGGAGAAGATGAGAAGCAT
                      ____________________________________________________________
consensus AGCCATGAAATTGGAGAGGTTGGAGAGGCGATTGTCGAAGCTGGAGAAGATGAGAAGCAT
 
. : . : . : . : . : . :
JMSF001F02+ GTCATCAGTGTTGACGTTTGTGGAGGTGTGGAGGCTCTTCACGATCTGCTGCGCTGTCGC
JMSF017K19+ GTCATCAGT
JMSF001D06+ GTCATCAGTGTTGACGTTTGTGGAGGTGTGGAGGCTCTTCACGATCTGCTGCGCTGTCGC
JMSF005J22+ GTCATCAGTGTTGACGTTTGTGGAGGTGTGGAGGCTCTTCACGATCTGCTGCGCTGTCGC
JMFF007B08+ GTCATCAGTGTTGACGTTTGTGGAGNTGTGGAGGCTCTTCACGATCTGCCGCGCTGTCGC
JMSF043G13+ GTCATCAGTGTTGACGTTTGTGGAGGTGTGGAGGCTCTTCACGATCTGCTGCGCTGTCGC
                      ____________________________________________________________
consensus GTCATCAGTGTTGACGTTTGTGGAGGTGTGGAGGCTCTTCACGATCTGCTGCGCTGTCGC
 
. : . : . : . : . : . :
JMSF001F02+ CAGAACCCTATCTT
JMSF001D06+ CAGAACCCTATCTT
JMSF005J22+ CAGAACCCTATCTTGCCCTTCCATCGCGCCTCTATGTCTCTCTGTCTTTC
JMFF007B08+ CAGAACCCTATCTTGCCCTTCCATCGCGCCTCTATGTCTCTCTGTCTTTC
JMSF043G13+ CAGAACCCTATCTTGCCCTTCCATCGCGCCTCTATGTCTCTCTGTCTTTCTTTCTCTCTC
                      ____________________________________________________________
consensus CAGAACCCTATCTTGCCCTTCCATCGCGCCTCTATGTCTCTCTGTCTTTCTTTCTCTCTC
 
. : . : . : . : . : . :
JMSF043G13+ TACACCACCCTCCTTCTCTCTCTATATATATACACACTCATTCACCGTATGTATCTATTC
                      ____________________________________________________________
consensus TACACCACCCTCCTTCTCTCTCTATATATATACACACTCATTCACCGTATGTATCTATTC