Previous Contig 007535:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF043D20Sequence872007535 (2)gb:AK118468_18164452e-16Arabidopsis thaliana At1g13570 mRNA for unknown protein, complete cds, clone: RA758007535 (2)gb:AK118468_18164452e-16Arabidopsis thaliana At1g13570 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043D20- GGATGCGAAAGGTGAAGCAAATTAGCAAACCC
                      ____________________________________________________________
consensus GGATGCGAAAGGTGAAGCAAATTAGCAAACCC
 
. : . : . : . : . : . :
rJMSF043D20+ TCTCGCCGCCTTGTCCGACAAACAATC
JMSF043D20- CCAGTCTCCCATAGTTCGATTATCCTCTTCGTTTCTCGCCGCCTTGTCCGACAAACAATC
                      ____________________________________________________________
consensus CCAGTCTCCCATAGTTCGATTATCCTCTTCGTTTCTCGCCGCCTTGTCCGACAAACAATC
 
. : . : . : . : . : . :
rJMSF043D20+ TCCGGCATACAACTTCACCGTGAATAACATCCTATTAGATTCATTCTAGCTACTAGCTAC
JMSF043D20- TCCGGCATACAACTTCACCGTGAATAACATCCTATTAGATTCATTCTAGCTACTAGCTAC
                      ____________________________________________________________
consensus TCCGGCATACAACTTCACCGTGAATAACATCCTATTAGATTCATTCTAGCTACTAGCTAC
 
. : . : . : . : . : . :
rJMSF043D20+ TCTACCAGGTGTTTACTTGATAGGTTATTGGATAATGGAACCGGGGAGAGATAGAATCAG
JMSF043D20- TCTACCAGGTGTTTACTTGATAGGTTATTGGATAATGGAACCGGGGAGAGATAGAATCAG
                      ____________________________________________________________
consensus TCTACCAGGTGTTTACTTGATAGGTTATTGGATAATGGAACCGGGGAGAGATAGAATCAG
 
. : . : . : . : . : . :
rJMSF043D20+ TCAACTTCCTGTAGAAATACTTGATCACATCTTGGAATTTTTGCCTATTAAAGATGCTGC
JMSF043D20- TCAACTTCCTGTAGAAATACTTGATCACATCTTGGAATTTTTGCCTATTAAAGATGCTGC
                      ____________________________________________________________
consensus TCAACTTCCTGTAGAAATACTTGATCACATCTTGGAATTTTTGCCTATTAAAGATGCTGC
 
. : . : . : . : . : . :
rJMSF043D20+ TAAAACCGCTGTTCTGTCTTCCGTTTGGAGAGATGTTTGGTCCAATCTCACACAACTTAA
JMSF043D20- TAAAACCGCTGTTCTGTCTTCCGTTTGGAGAGATGTTTGGTCCAATCTCACACAACTTAA
                      ____________________________________________________________
consensus TAAAACCGCTGTTCTGTCTTCCGTTTGGAGAGATGTTTGGTCCAATCTCACACAACTTAA
 
. : . : . : . : . : . :
rJMSF043D20+ CTTTGATCATCACTTCTTTTCTTATATGGATGAGAAACATTATCGTGCTAGCAATTATGT
JMSF043D20- CTTTGATCATCACTTCTTTTCTTATATGGATGAGAAACATTATCGTGCTAGCAATTATGT
                      ____________________________________________________________
consensus CTTTGATCATCACTTCTTTTCTTATATGGATGAGAAACATTATCGTGCTAGCAATTATGT
 
. : . : . : . : . : . :
rJMSF043D20+ CACAGAATCTGCCGCGGGTTTTTATGTGATCAACAAAGTTCTCCCCCAGCACAATGGAGC
JMSF043D20- CACAGAATCTGCCGCGGGTTTTTATGTGATCAACAAAGTTCTCCCCCAGCACAATGGAGC
                      ____________________________________________________________
consensus CACAGAATCTGCCGCGGGTTTTTATGTGATCAACAAAGTTCTCCCCCAGCACAATGGAGC
 
. : . : . : . : . : . :
rJMSF043D20+ AATTCAGAAATTTGTTCTCAAAATTCTTGATGTTGGGATATTCATAGTTAAGTCTTGGTC
JMSF043D20- AATTCAGAAATTTGTTCTCAAAATTCTTGATGTTGGGATATTCATAGTTAAGTCTTGGTC
                      ____________________________________________________________
consensus AATTCAGAAATTTGTTCTCAAAATTCTTGATGTTGGGATATTCATAGTTAAGTCTTGGTC
 
. : . : . : . : . : . :
rJMSF043D20+ TTATGACTTCGACCAATGGTTACTTTTAGTTACACGGAAAGGTGTTGAGGAAATGAAGAT
JMSF043D20- TTATGACTTCGACCAATGGTTACTTTTAGTTACACGGAAAGGTGTTGAGGAAATGAAGAT
                      ____________________________________________________________
consensus TTATGACTTCGACCAATGGTTACTTTTAGTTACACGGAAAGGTGTTGAGGAAATGAAGAT
 
. : . : . : . : . : . :
rJMSF043D20+ TAGTCTTGGGTATAATATATACAAGCTGCCGAATTATATATTTTCTTGTTCAACACTCAA
JMSF043D20- TAGTCTTGGGTATAATATATACAAGCTGCCGAATTATATATTTTCTTGTTCAACACTCAA
                      ____________________________________________________________
consensus TAGTCTTGGGTATAATATATACAAGCTGCCGAATTATATATTTTCTTGTTCAACACTCAA
 
. : . : . : . : . : . :
rJMSF043D20+ GAGGTTGCATCTTGCTTATGTCCTTGCATCTTGCTTATGTCGTTGTTCAACCAATGAATT
JMSF043D20- GAGGTTGCATCTTGCTTATGTCCTTGCATCTTGCTTATGTCGTTGTTCAACCAATGAATT
                      ____________________________________________________________
consensus GAGGTTGCATCTTGCTTATGTCCTTGCATCTTGCTTATGTCGTTGTTCAACCAATGAATT
 
. : . : . : . : . : . :
rJMSF043D20+ CTCCCAACATACTACCAAATGTTACTTTGCTTAGTTTTGATCATGTTAAATTTGATCCTA
JMSF043D20- CTCCCAACATACTACCAAATGTTACTTTGCTTAGTTTTGATCATGTTAAATTTGATCCTA
                      ____________________________________________________________
consensus CTCCCAACATACTACCAAATGTTACTTTGCTTAGTTTTGATCATGTTAAATTTGATCCTA
 
. : . : . : . : . : . :
rJMSF043D20+ TAAACCCTTCACCTTGTGCCATTGATGTTCCTGTACTTGAGAGTCTGTTAATTTGTTGGT
JMSF043D20- TAAACCCTTCACCTTGTGCCATTGATGTTCCTGTACTTGAGAGTCTGTTAATTTGTTGGT
                      ____________________________________________________________
consensus TAAACCCTTCACCTTGTGCCATTGATGTTCCTGTACTTGAGAGTCTGTTAATTTGTTGGT
 
. : . : . : . : . : . :
rJMSF043D20+ GTGAAAACACT
JMSF043D20- GTGAAAACACTTTTAATTTTAACATGACTGCTCCAAGCTATGTGATTTAACAAAAAAAAA
                      ____________________________________________________________
consensus GTGAAAACACTTTTAATTTTAACATGACTGCTCCAAGCTATGTGATTTAACAAAAAAAAA