Previous Contig 007534:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019J13Sequence460007534 (4)405007534 (4)
JMSF043D12Sequence590007534 (4)gb:AE017197_4022630.013Rickettsia typhi str. Wilmington complete genome.>gb:AY124983_590705 Rickettsia 512007534 (4)gb:AE017197_4022630.009Rickettsia typhi str. Wilmington complete genome.>gb:AY124983_590705 Rickettsia

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019J13- GGAGAGAAAATGGTGATCACAAATACTAACAGTGTCTCCTGCAGAAACAC
rJMSF043D12+ AGAGAAAATGGTGATCACAAATACTAACAGTGTCTCCTGCAGAAACAC
rJMSF019J13+ AGAGAAAATGGTGATCACAAATACTAACAGTGTCTCCTGCAGAAACAC
JMSF043D12- AGAGAAAATGGTGATCACAAATACTAACAGTGTCTCCTGCAGAAACAC
                      ____________________________________________________________
consensus GGAGAGAAAATGGTGATCACAAATACTAACAGTGTCTCCTGCAGAAACAC
 
. : . : . : . : . : . :
JMSF019J13- TGCTTTCTCTTATTTGTTCCCTCACAGAAGAAAATATGCAGCAGCATCTATTGCATTTGC
rJMSF043D12+ TGCTTTCTCTTATTTGTTCCCTCACAGAAGAAAATATGCAGCAGCATCTATTGCATTTGC
rJMSF019J13+ TGCTTTCTCTTATTTGTTCCCTCACAGAAGAAAATATGCAGCAGCATCTATTGCATTTGC
JMSF043D12- TGCTTTCTCTTATTTGTTCCCTCACAGAAGAAAATATGCAGCAGCATCTATTGCATTTGC
                      ____________________________________________________________
consensus TGCTTTCTCTTATTTGTTCCCTCACAGAAGAAAATATGCAGCAGCATCTATTGCATTTGC
 
. : . : . : . : . : . :
JMSF019J13- AGAAAAGAGAGACTTGGCTGAGAACAATCAACAAAAACCCATTTTCCCAATCAAACTCTC
rJMSF043D12+ AGAAAAGAGAGACTTGGCTGAGAACAATCAACAAAAACCCATTTTCCCAATCAAACTCTC
rJMSF019J13+ AGAAAAGAGAGACTTGGCTGAGAACAATCAACAAAAACCCATTTTCCCAATCAAACTCTC
JMSF043D12- AGAAAAGAGAGACTTGGCTGAGAACAATCAACAAAAACCCATTTTCCCAATCAAACTCTC
                      ____________________________________________________________
consensus AGAAAAGAGAGACTTGGCTGAGAACAATCAACAAAAACCCATTTTCCCAATCAAACTCTC
 
. : . : . : . : . : . :
JMSF019J13- TAAAACTCTTCTTGCTCAATCTGTTCTTGGAGTTTTTGCTTTAGGGTTCATAGATGCCGG
rJMSF043D12+ TAAAACTCTTCTTGCTCAATCTGTTCTTGGAGTTTTTGCTTTAGGGTTCATAGATGCCGG
rJMSF019J13+ TAAAACTCTTCTTGCTCAATCTGTTCTTGGAGTTTTTGCTTTAGGGTTCATAGATGCCGG
JMSF043D12- TAAAACTCTTCTTGCTCAATCTGTTCTTGGAGTTTTTGCTTTAGGGTTCATAGATGCCGG
                      ____________________________________________________________
consensus TAAAACTCTTCTTGCTCAATCTGTTCTTGGAGTTTTTGCTTTAGGGTTCATAGATGCCGG
 
. : . : . : . : . : . :
JMSF019J13- GTA
rJMSF043D12+ GTAATTTCCTTTTTTTAATTACATTTTTCCCCTTTCATTTCGGGTGTTTATTCTGATTTT
rJMSF019J13+ GTA
JMSF043D12- GTAATTTCCTTTTTTTAATTACATTTTTCCCCTTTCATTTCGGGTGTTTATTCTGATTTT
                      ____________________________________________________________
consensus GTAATTTCCTTTTTTTAATTACATTTTTCCCCTTTCATTTCGGGTGTTTATTCTGATTTT
 
. : . : . : . : . : . :
rJMSF043D12+ ATGTGTTTTATTTATTTATTTATTTATTAGGGGTATTGTATTTAAATGATTAAATCAGGT
JMSF043D12- ATGTGTTTTATTTATTTATTTATTTATTAGGGGTATTGTATTTAAATGATTAAATCAGGT
                      ____________________________________________________________
consensus ATGTGTTTTATTTATTTATTTATTTATTAGGGGTATTGTATTTAAATGATTAAATCAGGT
 
. : . : . : . : . : . :
rJMSF043D12+ ACAGTGGAGATTGGTCAAGAATTGGTGTCATCACAAAGGAGAGTGAACATCTACTGAAAA
JMSF043D12- ACAGTGGAGATTGGTCAAGAATTGGTGTCATCACAAAGGAGAGTGAACATCTACTGAAAA
                      ____________________________________________________________
consensus ACAGTGGAGATTGGTCAAGAATTGGTGTCATCACAAAGGAGAGTGAACATCTACTGAAAA
 
. : . : . : . : . : . :
rJMSF043D12+ TTTCAGCATTTTTTGTAGTCCCTTTGTGTCTGTTTCTCATCTTTTATTCCTCTAAGAAAA
JMSF043D12- TTTCAGCATTTTTTGTAGTCCCTTTGTGTCTGTTTCTCATCTTTTATTCCTCTAAGAAAA
                      ____________________________________________________________
consensus TTTCAGCATTTTTTGTAGTCCCTTTGTGTCTGTTTCTCATCTTTTATTCCTCTAAGAAAA
 
. : . : . : . : . : . :
rJMSF043D12+ TTAAGGATTAAAATGTCTCACATTTCTGACATATTAATTTAT
JMSF043D12- TTAAGGATTAAAATGTCTCACATTTCTGACATATTAATTTATTGTACACTTTCTATTTCC
                      ____________________________________________________________
consensus TTAAGGATTAAAATGTCTCACATTTCTGACATATTAATTTATTGTACACTTTCTATTTCC
 
. : . : . : . : . : . :
JMSF043D12- CAAGAAGATTATATTTTTTTAAAAAAAAAAAAAAAAAANAAAAAANNCCCNNANAAAAAA
                      ____________________________________________________________
consensus CAAGAAGATTATATTTTTTTAAAAAAAAAAAAAAAAAANAAAAAANNCCCNNANAAAAAA