Previous Contig 007525:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028M14Sequence510007525 (17)sp|P49107|PSAN_ARATH5e-40Photosystem I reaction centre subunit N, chloroplast precursor (PSI- N).>gb:AB00647007525 (17)gb:AF492824_18049904e-45Phaseolus vulgaris photosystem I-N subunit (PSI-N) mRNA, complete cds.
JMFF042I20Sequence630007525 (17)sp|P49107|PSAN_ARATH6e-51Photosystem I reaction centre subunit N, chloroplast precursor (PSI- N).>gb:AB00648007525 (17)gb:AF492824_18049903e-44Phaseolus vulgaris photosystem I-N subunit (PSI-N) mRNA, complete cds.
JMFF042L20Sequence645007525 (17)sp|P49107|PSAN_ARATH7e-51Photosystem I reaction centre subunit N, chloroplast precursor (PSI- N).>gb:AB00402007525 (17)gb:AF492824_18049904e-40Phaseolus vulgaris photosystem I-N subunit (PSI-N) mRNA, complete cds.
JMFF051L09Sequence630007525 (17)sp|P49107|PSAN_ARATH3e-50Photosystem I reaction centre subunit N, chloroplast precursor (PSI- N).>gb:AB00427007525 (17)gb:AF492824_18049901e-39Phaseolus vulgaris photosystem I-N subunit (PSI-N) mRNA, complete cds.
JMFN012H23Sequence633007525 (17)sp|P49107|PSAN_ARATH6e-51Photosystem I reaction centre subunit N, chloroplast precursor (PSI- N).>gb:AB00
JMSF032B19Sequence717007525 (17)sp|P49107|PSAN_ARATH8e-51Photosystem I reaction centre subunit N, chloroplast precursor (PSI- N).>gb:AB00658007525 (17)sp|P49107|PSAN_ARATH7e-51Photosystem I reaction centre subunit N, chloroplast precursor (PSI- N).>gb:AB00
JMSF036J02Sequence653007525 (17)sp|P49107|PSAN_ARATH4e-50Photosystem I reaction centre subunit N, chloroplast precursor (PSI- N).>gb:AB00609007525 (17)gb:AF492824_18049902e-44Phaseolus vulgaris photosystem I-N subunit (PSI-N) mRNA, complete cds.
JMSF043B03Sequence618007525 (17)sp|P49107|PSAN_ARATH6e-51Photosystem I reaction centre subunit N, chloroplast precursor (PSI- N).>gb:AB00613007525 (17)gb:AF492824_18049906e-45Phaseolus vulgaris photosystem I-N subunit (PSI-N) mRNA, complete cds.
JMSF053A13Sequence680007525 (17)sp|P49107|PSAN_ARATH8e-51Photosystem I reaction centre subunit N, chloroplast precursor (PSI- N).>gb:AB00685007525 (17)sp|P49107|PSAN_ARATH8e-51Photosystem I reaction centre subunit N, chloroplast precursor (PSI- N).>gb:AB00

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF051L09- ACCCTGGAGAGTTTTTTTTTTTTTT
                      ____________________________________________________________
consensus ACCCTGGAGAGTTTTTTTTTTTTTT
 
. : . : . : . : . : . :
rJMFF051L09- TTGGTTTTTTTTTTTTTTGCGTAGGATGAGAGGTTGCAAAG-TATTGAAGGAGAAAGCAG
rJMFF042I20- TGCGTAGGATGAGAGGTTGCAAAG-TATTGAAGGAGAAAGCAG
rJMFF042L20- TGCGTAGGATGAGAGGTTGCAAAG-TATTGAAGGAGAAAGCAG
rJMFF028M14- TGCGTAGGATGAGAGGTTGCAAAG-TATTGAAGGAGAAAGCAG
rJMSF043B03- TGCGTAGGATGAGAGGTTGCAAAG-TATTGAAGGAGAAAGCAG
rJMSF036J02- ATGAGAGGTTGCAAAGTTATTGAAGGAGAAAGCAG
JMSF032B19+ TTGAAGGAGAAAGCAG
                      ____________________________________________________________
consensus TTGGTTTTTTTTTTTTTTGCGTAGGATGAGAGGTTGCAAAG-TATTGAAGGAGAAAGCAG
 
. : . : . : . : . : . :
rJMFF051L09- TAGAGATAATACCTGG-AAGAAGAAGAGATACAAGTTCAATCTAAAAAGAGCACTCAATA
rJMFF042I20- TAGAGATAATACATGG-AAGAAGAAGAGATACAAGTTCAATCTAAAAAGAGCATTCAATA
rJMFF042L20- TAGAGATAATACATGG-AAGAAGAAGAGATACAAGTTCAATCTAAAAAGAGCATTCAATA
rJMFF028M14- TAGAGATAATACATGG-AAGAAGAAGAGATACAAGTTCAATCTAAAAAGAGCATTCAATA
rJMSF043B03- TAGAGATAATACATGG-AAGAAGAAGAGATACAAGTTCAATCTAAAAAGAGCATTCAATA
rJMSF036J02- TAGAGATAATACATGGCAAGAAGAAGAGATACAAGTTCAATCTAAAAAGAGCATTCAATA
JMFF042L20+ GAGCATTCAATA
rJMSF053A13- ATACATGG-AAGAAGAAGAGATACAAGTTCAATCTAAAAAGAGCATTCAATA
JMSF053A13+ TGG-AAGAAGAAGAGATACAAGTTCAATCTAAAAAGAGCATTCAATA
JMFN012H23+ TCTAAAAAGAGCATTCAATA
JMFF042I20+ A
rJMSF032B19- AGTTCAATCTAAAAAGAGCATTCAATA
JMSF036J02+ CTAAAAAGAGCATTCAATA
JMSF032B19+ TAGAGATAATACATGG-AAGAAGAAGAGATACAAGTTCAATCTAAAAAGAGCATTCAATA
                      ____________________________________________________________
consensus TAGAGATAATACATGG-AAGAAGAAGAGATACAAGTTCAATCTAAAAAGAGCATTCAATA
 
. : . : . : . : . : . :
rJMFF051L09- ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
rJMFF042I20- ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
rJMFF042L20- ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
rJMFF028M14- ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
rJMSF043B03- ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
rJMSF036J02- ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
JMFF051L09+ AATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
JMFF042L20+ ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
rJMSF053A13- ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
JMSF053A13+ ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
JMFN012H23+ ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
JMFF042I20+ ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
rJMSF032B19- ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
JMSF036J02+ ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
JMSF032B19+ ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
JMSF043B03+ ACATTTCACCATTTCCAGAA
                      ____________________________________________________________
consensus ATTAATTAGGCATGAATGAAATGAGCGGTCTCACAGTCCCACATTTCACCATTTCCAGAA
 
. : . : . : . : . : . :
rJMFF051L09- AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
rJMFF042I20- AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
rJMFF042L20- AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
rJMFF028M14- AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
rJMSF043B03- AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
rJMSF036J02- AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
JMFF051L09+ AACATTGGAACCACACTNGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
JMFF042L20+ AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
rJMSF053A13- AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
JMSF053A13+ AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
JMFN012H23+ AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
JMFF042I20+ AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
JMFF028M14+ CCTTCGCATTCTAATTCCAGGTCATCTGA
rJMSF032B19- AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
JMSF036J02+ AACATNGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
JMSF032B19+ AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
JMSF043B03+ AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
                      ____________________________________________________________
consensus AACATTGGAACCACACTTGTATTTGTCCTTCCCTTCGCATTCTAATTCCAGGTCATCTGA
 
. : . : . : . : . : . :
rJMFF051L09- GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
rJMFF042I20- GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
rJMFF042L20- GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
rJMFF028M14- GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
rJMSF043B03- GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
rJMSF036J02- GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
JMFF051L09+ GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
JMFF042L20+ GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
rJMSF053A13- GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
JMSF053A13+ GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
JMFN012H23+ GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
JMFF042I20+ GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
JMFF028M14+ GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
rJMSF032B19- GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
JMSF036J02+ GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
JMSF032B19+ GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
JMSF043B03+ GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
                      ____________________________________________________________
consensus GATGAATGGCACTTTCTTTTGCTTGGCAAGGTCTTGACAGCCGGTGAAGTTTTCAGGGAA
 
. : . : . : . : . : . :
rJMFF051L09- CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
rJMFF042I20- CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
rJMFF042L20- CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
rJMFF028M14- CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
rJMSF043B03- CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
rJMSF036J02- CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
JMFF051L09+ CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
JMFF042L20+ CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
rJMSF053A13- CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
JMSF053A13+ CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
JMFN012H23+ CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
JMFF042I20+ CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
JMFF028M14+ CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
rJMSF032B19- CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
JMSF036J02+ CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
JMSF032B19+ CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
JMSF043B03+ CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
                      ____________________________________________________________
consensus CTTGCAGCTCCCAAATTGAACTGTGTATGCTCTTGCAAAGTTTGCTCCACTTGTTGCCAG
 
. : . : . : . : . : . :
rJMFF051L09- CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGA
rJMFF042I20- CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
rJMFF042L20- CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGA
rJMFF028M14- CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
rJMSF043B03- CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
rJMSF036J02- CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
JMFF051L09+ CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
JMFF042L20+ CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
rJMSF053A13- CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
JMSF053A13+ CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
JMFN012H23+ CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
JMFF042I20+ CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
JMFF028M14+ CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
rJMSF032B19- CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
JMSF036J02+ CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
JMSF032B19+ CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
JMSF043B03+ CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
                      ____________________________________________________________
consensus CCTCTTCTTGTCATTCAACTCCTTGTTGGCCTTGCTTTTCTCGAGATAGTCCTCAATGAC
 
. : . : . : . : . : . :
rJMFF042I20- GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
rJMFF028M14- GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
rJMSF043B03- GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
rJMSF036J02- GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
JMFF051L09+ GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
JMFF042L20+ GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
rJMSF053A13- GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
JMSF053A13+ GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
JMFN012H23+ GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
JMFF042I20+ GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
JMFF028M14+ GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
rJMSF032B19- GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
JMSF036J02+ GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
JMSF032B19+ GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
JMSF043B03+ GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
                      ____________________________________________________________
consensus GCCAGCGTTTGCTGAGGAAGTGGATGCTGCGGCGGTGAAAAGGGCAGTTGCGAGGCCGAG
 
. : . : . : . : . : . :
rJMFF042I20- AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
rJMFF028M14- AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
rJMSF043B03- AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
rJMSF036J02- AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
JMFF051L09+ AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
JMFF042L20+ AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
rJMSF053A13- AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
JMSF053A13+ AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
JMFN012H23+ AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
JMFF042I20+ AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
JMFF028M14+ AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
rJMSF032B19- AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
JMSF036J02+ AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
JMSF032B19+ AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
JMSF043B03+ AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
                      ____________________________________________________________
consensus AAGGGCAGCTCTTCTCCCTTGCTGGCTGCCGTTTTCGGAATCCAAAGCTGTTCTTGGTGG
 
. : . : . : . : . : . :
rJMFF042I20- TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
rJMFF028M14- TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCATGGGATGCCG
rJMSF043B03- TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
rJMSF036J02- TGGTTGTTGTTGGGCCTTGATTGCCANCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
JMFF051L09+ TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
JMFF042L20+ TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
rJMSF053A13- TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
JMSF053A13+ TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
JMFN012H23+ TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
JMFF042I20+ TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
JMFF028M14+ TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
rJMSF032B19- TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
JMSF036J02+ TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
JMSF032B19+ TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
JMSF043B03+ TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
                      ____________________________________________________________
consensus TGGTTGTTGTTGGGCCTTGATTGCCAGCAGCTTTGAAGGGGGTGAGACCAT-GGATGCCG
 
. : . : . : . : . : . :
rJMFF042I20- ACATTGAAGCAGCC-TTTGCATTGAGCTC
rJMFF028M14- ACATTGAAGCAGCC-TTTGCATTGAGCTCA
rJMSF043B03- ACATTGAANCAGCC-NTTGCATTGAGCTCA
rJMSF036J02- ACATTGAAGCAGCCTTTTGCATTGAGCTCAGATGA
JMFF051L09+ ACATTGAAGCAGCC-TTTGCATTGAGCTCAGATGAAGCAGCCCCTGATATGGCATAGCTG
JMFF042L20+ ACATTGAAGCAGCC-TTTGCATTGAGCTCAGATGAAGCAGCCCCTGATATGGCATAGCTG
rJMSF053A13- ACATTGAAGCAGCC-TTTGCATTGAGCTCAGATGAAGCAGCCCCTGATATGGCATAGCTG
JMSF053A13+ ACATTGAAGCAGCC-TTTGCATTGAGCTCAGATGAAGCAGCCCCTGATATGGCATAGCTG
JMFN012H23+ ACATTGAAGCAGCC-TTTGCATTGAGCTCAGATGAAGCAGCCCCTGATATGGCATAGCTG
JMFF042I20+ ACATTGAAGCAGCC-TTTGCATTGAGCTCAGATGAAGCAGCCCCTGATATGGCATAGCTG
JMFF028M14+ ACATTGAAGCAGCC-TTTGCATTGAGCTCAGATGAAGCAGCCCCTGATATGGCATAGCTG
rJMSF032B19- ACATTGAAGCAGCC-TTTGCATTGAGCTCAGATGAAGCAGCCCCTGATATGGCATAGCTG
JMSF036J02+ ACATTGAAGCAGCC-TTTGCATTGAGCTCAGATGAAGCAGCCCCTGATATGGCATAGCTG
JMSF032B19+ ACATTGAAGCAGCC-TTTGCATTGAGCTCAGATGAAGCAGCCCCTGATATGGCATAGCTG
JMSF043B03+ ACATTGAAGCAGCC-TTTGCATTGAGCTCAGATGAAGCAGCCCCTGATATGGCATAGCTG
                      ____________________________________________________________
consensus ACATTGAAGCAGCC-TTTGCATTGAGCTCAGATGAAGCAGCCCCTGATATGGCATAGCTG
 
. : . : . : . : . : . :
JMFF051L09+ CATGCCAATACACTGGAGTTCATGGCAGCCATTATCACTATAGATCGAGAAAGCTAGATT
JMFF042L20+ CATGCCAATACACTGGAGTTCATGGCAGCCATTATCACTATAGATCGAGAAAGCTAGATT
rJMSF053A13- CATGCCAATACACTGGAGTTCATGGCAGCCATTATCACTATAGATCGAGAAAGCTAGATT
JMSF053A13+ CATGCCAATACACTGGAGTTCATGGCAGCCATTATCACTATAGATCGAGAAAGCTAGATT
JMFN012H23+ CATGCCAATACACTGGAGTTCATGGCAGCCATTATCACTATAGATCGAGAAAGCTAGATT
JMFF042I20+ CATGCCAATACACTGGAGTTCATGGCAGCCATTATCACTATAGATCGAGAAAGCTAGATT
JMFF028M14+ CATGCCAATACACTGGAGTTCATGGCAGCCATTATCACTATAGATCGAGAAAGCTAGATT
rJMSF032B19- CATGCCAATACACTGGAGTTCATGGCAGCCATTATCACTATAGATCGAGAAAGCTAGATT
JMSF036J02+ CATGCCAATACACTGGAGTTCATGGCAGCCATTATCACTATAGATCGAGAAAGCTAGATT
JMSF032B19+ CATGCCAATACACTGGAGTTCATGGCAGCCATTATCACTATAGATCGAGAAAGCTAGATT
JMSF043B03+ CATGCCAATACACTGGAGTTCATGGCAGCCATTATCACTATAGATCGAGAAAGCTAGATT
                      ____________________________________________________________
consensus CATGCCAATACACTGGAGTTCATGGCAGCCATTATCACTATAGATCGAGAAAGCTAGATT
 
. : . : . : . : . : . :
JMFF051L09+ GATGAGAAATTTTGGTTTTCTTTTTATTTATTGT
JMFF042L20+ GATGAGAAATTTTGGTTTTCTTTTTATTTATTGT
rJMSF053A13- GATGAGAAATTTTGGTTTTCTTTTTATTTATTGTTC
JMSF053A13+ GATGAGAAATTTTGGTTTTCTTTTTATTTATTGTTC
JMFN012H23+ GATGAGAAATTTTGG
JMFF042I20+ GATGAGAAATTTTGGTTTTCTTTTTATTTAT
JMFF028M14+ GAT
rJMSF032B19- GATGAGAAATTTTGGTTTTCTTTTTATTTATTG
JMSF036J02+ GATGAGAAATTTTGGTTTTCTTTTTATTTATTGTTC
JMSF032B19+ GATGAGAAATTTTGGTTTTCTTTTTATTTATTGTTC
JMSF043B03+ GATGAGAAATTTTGGTTTTCTTTTTATTTATTGTTATTTTAATTTTTGGGTTTATGATTC
                      ____________________________________________________________
consensus GATGAGAAATTTTGGTTTTCTTTTTATTTATTGTTCTTTTAATTTTTGGGTTTATGATTC