Previous Contig 007521:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035F16Sequence495007521 (3)gb:ATT5E8_15561372e-07Arabidopsis thaliana DNA chromosome 5, BAC clone T5E8 (ESSA project).229013448 (3)
JMSF042O10Sequence747007521 (3)gb:ATT5E8_15561375e-31Arabidopsis thaliana DNA chromosome 5, BAC clone T5E8 (ESSA project).561013448 (3)gb:ATT5E8_15561370.002Arabidopsis thaliana DNA chromosome 5, BAC clone T5E8 (ESSA project).
JMSF049B23Sequence687007521 (3)gb:ATT5E8_15561372e-28Arabidopsis thaliana DNA chromosome 5, BAC clone T5E8 (ESSA project).701013448 (3)gb:ATT5E8_15561371e-51Arabidopsis thaliana DNA chromosome 5, BAC clone T5E8 (ESSA project).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042O10+ TGGTATCAGTAGCAAGAGCAAAGTCAAC
                      ____________________________________________________________
consensus TGGTATCAGTAGCAAGAGCAAAGTCAAC
 
. : . : . : . : . : . :
JMSF049B23+ CTAGATGAGCCTCCAGGAACATGAAATGG
JMSF042O10+ AAGATTGGATGCAACAGCAACCGCTGAACCACTAGATGAGCCTCCAGGAACATGAAATGG
                      ____________________________________________________________
consensus AAGATTGGATGCAACAGCAACCGCTGAACCACTAGATGAGCCTCCAGGAACATGAAATGG
 
. : . : . : . : . : . :
JMSF049B23+ CAATTTGGGGTTAGTTGGTGTTCCATAGTGCACATTTCTTCCAGTGATCCCCAAACCAAG
JMSF042O10+ CAATTTGGGGTTAGTTGGTGTTCCATAGTGCACATTTCTTCCAGTGATCCCCAAACCAAG
                      ____________________________________________________________
consensus CAATTTGGGGTTAGTTGGTGTTCCATAGTGCACATTTCTTCCAGTGATCCCCAAACCAAG
 
. : . : . : . : . : . :
JMSF049B23+ TTCATCCATAATCGTCTTGCCAATGCAAGTAGCTCCACTCTTCAGTAGAGCGTAGACTAC
JMSF042O10+ TTCATCCATAATCGTCTTGCCAATGCAAGTAGCTCCACTCTTCAGTAGAGCGTAGACTAC
                      ____________________________________________________________
consensus TTCATCCATAATCGTCTTGCCAATGCAAGTAGCTCCACTCTTCAGTAGAGCGTAGACTAC
 
. : . : . : . : . : . :
JMSF049B23+ CGCCGCCGTCTCTGCAGCCGCTTCATGTGTCCGTTTCCACTCTGGGCTCCCAAGCCCCGT
JMFF035F16+ CTGGGCTCCCAAGCCCCGT
JMSF042O10+ CGCCGCCGTCTCTGCAGCCGCTTCATGTGTCCGTTTCCACTCTGGGCTCCCAAGCCCCGT
                      ____________________________________________________________
consensus CGCCGCCGTCTCTGCAGCCGCTTCATGTGTCCGTTTCCACTCTGGGCTCCCAAGCCCCGT
 
. : . : . : . : . : . :
JMSF049B23+ TACGTACCCCTTCACATCAATATTGTCTTTGATGGCAAACGTGAGGCCGGCGAGGAGGAG
JMFF035F16+ TACGTACCCCTTCACATCAATATTGTCTTTGATGGCAAACGTGAGGCCGGCGAGGAGGAG
JMSF042O10+ TACGTACCCCTTCACATCAATATTGTCTTTGATGGCAAACGTGAGGCCGGCGAGGAGGAG
                      ____________________________________________________________
consensus TACGTACCCCTTCACATCAATATTGTCTTTGATGGCAAACGTGAGGCCGGCGAGGAGGAG
 
. : . : . : . : . : . :
JMSF049B23+ CGGAGCAGCGGGAGGAGGGGGTTGAGGAAAAAGGAAGCAACTCGAAACGCTCGATGAAGG
JMFF035F16+ CGGAGCAGCGGGAGGAGGGGGTTGAGG-AAAAGGAAGCAACTCGAAACGCTCGATGAAGG
JMSF042O10+ CGGAGCAGCGGGAGGAGGGGGTTGAGG-AAAAGGAAGCAACTCGAAACGCTCGATGAAGG
                      ____________________________________________________________
consensus CGGAGCAGCGGGAGGAGGGGGTTGAGG-AAAAGGAAGCAACTCGAAACGCTCGATGAAGG
 
. : . : . : . : . : . :
JMSF049B23+ CCCCAAAATCTTCCTTAATCGCGTCACTGGCACTCAGCCGGCGGCGGCGGTGGACCTCGG
JMFF035F16+ CCCCAAAATCTTCCTTAATCGCGTCACTGGCACTCAGCCGGCGGCGGCGGTGGACCTCGG
JMSF042O10+ CCCCAAAATCTTCCTTAATCGCGTCACTGGCACTCAGCCGGCGGCGGCGGTGGACCTCGG
                      ____________________________________________________________
consensus CCCCAAAATCTTCCTTAATCGCGTCACTGGCACTCAGCCGGCGGCGGCGGTGGACCTCGG
 
. : . : . : . : . : . :
JMSF049B23+ CTAGAATCACGATCCCGGCGACTCCAACGCCTATCACCACCCAAAGCTTGGGATTCGAGG
JMFF035F16+ CTAGAATCACGATCCCGGCGACTCCAACGCCTATCACCACCCAAAGCTTGGGATTCGAGG
JMSF042O10+ CTAGAATCACGATCCCGGCGACTCCAACGCCTATCACCACCCAAAGCTTGGGATTCGAGG
                      ____________________________________________________________
consensus CTAGAATCACGATCCCGGCGACTCCAACGCCTATCACCACCCAAAGCTTGGGATTCGAGG
 
. : . : . : . : . : . :
JMSF049B23+ CGCTGAGCTTCGACAGCTTTGTCATGGCCGGAAATGTCCGCCGGTTGGTGGGCTAAATTT
JMFF035F16+ CGCTGAGCTTCGACAGCTTTGTCATGGCCGGAAATGTCCGCCGGTTGGTGGGCTAAATTT
JMSF042O10+ CGCTGAGCTTCGACAGCTTTGTCATGGCCGGAAATGTCCGCCGGTTGGTGGGCTAAATTT
                      ____________________________________________________________
consensus CGCTGAGCTTCGACAGCTTTGTCATGGCCGGAAATGTCCGCCGGTTGGTGGGCTAAATTT
 
. : . : . : . : . : . :
JMSF049B23+ AGGGTTTTTGAAGGGTTTAAGAGAGTTTTCTAAAACTCAGAAAGGGGATTGCAATTTGCA
JMFF035F16+ AGGGTTTTTGAAGGGTTTAAGAGAGTTTTCTAAAACTCAGAAAGGGGATTGCAATTTGCA
JMSF042O10+ AGGGTTTTTGAAGGGTTTAAGAGAGTTTTCTAAAACTCAGAAAGGGGATTGCAATTTGCA
                      ____________________________________________________________
consensus AGGGTTTTTGAAGGGTTTAAGAGAGTTTTCTAAAACTCAGAAAGGGGATTGCAATTTGCA
 
. : . : . : . : . : . :
JMSF049B23+ ACCTCGCAACAGTGTAAACCATCAAAGGATGCGCGCGCGTTGTCTAGACTCGATAAACTT
JMFF035F16+ ACCTCGCAACAGTGTAAACCATCAAAGGATGCGCGCGCGTTGTCTAGACTCGATAAACTT
JMSF042O10+ ACCTCGCAACAGTGTAAACCATCAAAGGATGCGCGCGCGTTGTCTAGACTCGATAAACTT
                      ____________________________________________________________
consensus ACCTCGCAACAGTGTAAACCATCAAAGGATGCGCGCGCGTTGTCTAGACTCGATAAACTT
 
. : . : . : . : . : . :
JMSF049B23+ CCTCCTTTCTCCCCACACCGAATCACAATGAAAAGTTGGCAAAAACCAAAAGATCAT
JMFF035F16+ CCTCCTTTCTCCCCACACCGAATCACAATGAAAAGTTGGCAAAAACCAAAAGATCAT
JMSF042O10+ CCTCCTTTCTCCCCACACCGAATCACAATGAAAAGTTGGCAAAAACCAAAAGATCATACC
                      ____________________________________________________________
consensus CCTCCTTTCTCCCCACACCGAATCACAATGAAAAGTTGGCAAAAACCAAAAGATCATACC