Previous Contig 007520:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS151F03Sequence350007520 (4)
JMSF007H13Sequence475007520 (4)678013447 (3)gb:AP004378_18409911e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P049
JMSF010E15Sequence247007520 (4)739013447 (3)gb:AP004378_18409917e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P049
JMSF042O05Sequence761007520 (4)592013447 (3)gb:AP004378_18409917e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P049

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042O05+ CTCAGAGATGCACAAACTGGTAATATTGACATTCTTGACCA
                      ____________________________________________________________
consensus CTCAGAGATGCACAAACTGGTAATATTGACATTCTTGACCA
 
. : . : . : . : . : . :
JMSF042O05+ CTGGAGATCCTTCATTTCCATTTGTGATTGCATTGGGAATCCCTCCATTTTGTTGAAGAA
                      ____________________________________________________________
consensus CTGGAGATCCTTCATTTCCATTTGTGATTGCATTGGGAATCCCTCCATTTTGTTGAAGAA
 
. : . : . : . : . : . :
JMSF042O05+ CCCCTGAAGAGATATCTGCCACTGGCTTAACACCCCTGGCTCTCTCCTCGTGAGTGCTAT
                      ____________________________________________________________
consensus CCCCTGAAGAGATATCTGCCACTGGCTTAACACCCCTGGCTCTCTCCTCGTGAGTGCTAT
 
. : . : . : . : . : . :
JMSF042O05+ GGGATTCTTGTCCTTTTGAGGAACCAGGCTGCATGATTGATGCAGTGCTGAAACTGCCAA
                      ____________________________________________________________
consensus GGGATTCTTGTCCTTTTGAGGAACCAGGCTGCATGATTGATGCAGTGCTGAAACTGCCAA
 
. : . : . : . : . : . :
JMSF007H13+ GGGCTGGTTTTGATGAATCATCCTGTGATACTTTCTTGTCAGAAGTCT
JMSF042O05+ ATGATAATTCAGGGGCTGGTTTTGATGAATCATCCTGTGATACTTTCTTGTCAGAAGTCT
                      ____________________________________________________________
consensus ATGATAATTCAGGGGCTGGTTTTGATGAATCATCCTGTGATACTTTCTTGTCAGAAGTCT
 
. : . : . : . : . : . :
JMSF007H13+ TCTTTTCAGTATTTCCAGATGACTGTGTAAACCATGATTTGGTTTCATCCTCAGTAAAGG
JMSF042O05+ TCTTTTCAGTATTTCCAGATGACTGTGTAAACCATGATTTGGTTTCATCCTCAGTAAAGG
                      ____________________________________________________________
consensus TCTTTTCAGTATTTCCAGATGACTGTGTAAACCATGATTTGGTTTCATCCTCAGTAAAGG
 
. : . : . : . : . : . :
JMSF010E15+ GAATCACTCATGTTGCGTATAGAGCCTTGAACTAAACAAA
JMSF007H13+ AACCAAATAAAAGCATCTTAGAATCACTCATGTTGCGTATAGAGCCTTGAACTAAACAAA
JMFS151F03- CCTTGAACTAAACAAA
JMSF042O05+ AACCAAATAAAAGCATCTTAGAATCACTCATGTTGCGTATAGAGCCTTGAACTAAACAAA
                      ____________________________________________________________
consensus AACCAAATAAAAGCATCTTAGAATCACTCATGTTGCGTATAGAGCCTTGAACTAAACAAA
 
. : . : . : . : . : . :
JMSF010E15+ CAACAACTTTTATTATTACGATCAGGTAATGAAGACAGGTGCATAGAAAAGTGGCGGAAA
JMSF007H13+ CAACAACTTTTATTATTACGATCAGGTAATGAAGACAGGTGCATAGAAAAGTGGCGGAAA
JMFS151F03- CAACAACTTTTATTATTACGATCAGGTAATGAAGACAGGTGCATAGAAAAGTGGCGGAAA
JMSF042O05+ CAACAACTTTTATTATTACGATCAGGTAATGAAGACAGGTGCATAGAAAAGTGGCGGAAA
                      ____________________________________________________________
consensus CAACAACTTTTATTATTACGATCAGGTAATGAAGACAGGTGCATAGAAAAGTGGCGGAAA
 
. : . : . : . : . : . :
JMSF010E15+ ACTAAGGGTAGTTTCTGAAAAGGAGGCCTTGTTGTTGCATAGCCGGTGCTATCAACAGAA
JMSF007H13+ ACTAAGGGTAGTTTCTGAAAAGGAGGCCTTGTTGTTGCATAGCCGGTGCTATCAACAGAA
JMFS151F03- ACTAAGGGTAGTTTCTGAAAAGGAGGCCTTGTTGTTGCATAGCCGGTGCTATCAACAGAA
JMSF042O05+ ACTAAGGGTAGTTTCTGAAAAGGAGGCCTTGTTGTTGCATAGCCGGTGCTATCAACAGAA
                      ____________________________________________________________
consensus ACTAAGGGTAGTTTCTGAAAAGGAGGCCTTGTTGTTGCATAGCCGGTGCTATCAACAGAA
 
. : . : . : . : . : . :
JMSF010E15+ GACATGAACTGAAGAGACAGAAACGAAGAGAGTATTGAAGGAATGCTCGGTCGTCGCAGA
JMSF007H13+ GACATGAACTGAAGAGACAGAAACGAAGAGAGTATTGAAGGAATGCTCGGTCGTCGCAGA
JMFS151F03- GACATGAACTGAAGAGACAGAAACGAAGAGAGTATTGAAGGAATGCTCGGTCGTCGCAGA
JMSF042O05+ GACATGAACTGAAGAGACAGAAACGAAGAGAGTATTGAAGGAATGCTCGGTCGTCGCAGA
                      ____________________________________________________________
consensus GACATGAACTGAAGAGACAGAAACGAAGAGAGTATTGAAGGAATGCTCGGTCGTCGCAGA
 
. : . : . : . : . : . :
JMSF010E15+ GATTGTTGGCCGACGATCCGATCGCC
JMSF007H13+ GATTGTTGGCCGACGATCCGATCGCCAATCGAAGCATCAGCTGCAAAACCCAACCCGATT
JMFS151F03- GATTGTTGGCCGACGATCCGATCGCCAATCGAAGCATCAGCTGCAAAACCCAACCCGATT
JMSF042O05+ GATTGTTGGCCGACGATCCGATCGCCAATCGAAGCATCAGCTGCAAAACCCAACCCGATT
                      ____________________________________________________________
consensus GATTGTTGGCCGACGATCCGATCGCCAATCGAAGCATCAGCTGCAAAACCCAACCCGATT
 
. : . : . : . : . : . :
JMSF007H13+ GAATTCCCAGCTTTGTGCTGCGGCTTGCGGTGCGTTTATGGAGATGGAGGCGATGAAGTA
JMFS151F03- GAATTCCCAGCTTTGTGCTGCGGCTTGCGGTGCGTTTATGGAGATGGAGGCGATGAAGTA
JMSF042O05+ GAATTCCCAGCTTTGTGCTGCGGCTTGCGGTGCGTTTATGGAGATGGAGGCGATGAAGTA
                      ____________________________________________________________
consensus GAATTCCCAGCTTTGTGCTGCGGCTTGCGGTGCGTTTATGGAGATGGAGGCGATGAAGTA
 
. : . : . : . : . : . :
JMSF007H13+ TTCAGC
JMFS151F03- TTCAGCGGCTCGGGTTTAGGTTTGTCATGTAAAA
JMSF042O05+ TTCAGCGGCTCGGGTTTAGGTTTGTCATGTAAAAAGGATATACTGCTACTTCTGATGATC
                      ____________________________________________________________
consensus TTCAGCGGCTCGGGTTTAGGTTTGTCATGTAAAAAGGATATACTGCTACTTCTGATGATC