Previous Contig 007517:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF041N16Sequence726007517 (4)pir|T01744|T017446e-70ribosomal protein L17, chloroplast - common tobacco>gb:AB010880_1511282 Nicotian670007517 (4)pir|T01744|T017445e-70ribosomal protein L17, chloroplast - common tobacco>gb:AB010880_1511282 Nicotian
JMSF042N16Sequence733007517 (4)pir|T01744|T017446e-70ribosomal protein L17, chloroplast - common tobacco>gb:AB010880_1511282 Nicotian694007517 (4)pir|T01744|T017446e-70ribosomal protein L17, chloroplast - common tobacco>gb:AB010880_1511282 Nicotian

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042N16+ CGAGAGACAGAGA
rJMSF041N16+ CGAGAGACAGAGA
JMSF041N16- CGAGAGACAGAGA
JMSF042N16- CGAGAGACAGAGA
                      ____________________________________________________________
consensus CGAGAGACAGAGA
 
. : . : . : . : . : . :
rJMSF042N16+ GAGCAATCGAAAATGGCGGCGTGTGCGAGCACTTCAGCNTCCGCAGCATGGAATATGGCT
rJMSF041N16+ GAGCAATCGAAAATGGCGGCGTGTGCGAGCACTTCAGCCTCCGCAGCATGGAATATGGCT
JMSF041N16- GAGCAATCGAAAATGGCGGCGTGTGCGAGCACTTCAGCCTCCGCAGCATGGAATATGGCT
JMSF042N16- GAGCAATCGAAAATGGCGGCGTGTGCGAGCACTTCAGCCTCCGCAGCATGGAATATGGCT
                      ____________________________________________________________
consensus GAGCAATCGAAAATGGCGGCGTGTGCGAGCACTTCAGCCTCCGCAGCATGGAATATGGCT
 
. : . : . : . : . : . :
rJMSF042N16+ CCGCTAAGATCAGCGCTTCCTTGTATTCACGCCTCTTCCACCTCTTCCCTTCGTTTCTCA
rJMSF041N16+ CCGCTAAGATCAGCGCTTCCTTGTATTCACGCCTCTTCCACCTCTTCCCTTCGTTTCTCA
JMSF041N16- CCGCTAAGATCAGCGCTTCCTTGTATTCACGCCTCTTCCACCTCTTCCCTTCGTTTCTCA
JMSF042N16- CCGCTAAGATCAGCGCTTCCTTGTATTCACGCCTCTTCCACCTCTTCCCTTCGTTTCTCA
                      ____________________________________________________________
consensus CCGCTAAGATCAGCGCTTCCTTGTATTCACGCCTCTTCCACCTCTTCCCTTCGTTTCTCA
 
. : . : . : . : . : . :
rJMSF042N16+ TCTAGGTCTTCTTCCTCTCCACTCAGGCTTTCCCGCCCCAAGTCTCAACCAGGAACTGTC
rJMSF041N16+ TCTAGGTCTTCTTCCTCTCCACTCAGGCTTTCCCGCCCCAAGTCTCAACCAGGAACTGTC
JMSF041N16- TCTAGGTCTTCTTCCTCTCCACTCAGGCTTTCCCGCCCCAAGTCTCAACCAGGAACTGTC
JMSF042N16- TCTAGGTCTTCTTCCTCTCCACTCAGGCTTTCCCGCCCCAAGTCTCAACCAGGAACTGTC
                      ____________________________________________________________
consensus TCTAGGTCTTCTTCCTCTCCACTCAGGCTTTCCCGCCCCAAGTCTCAACCAGGAACTGTC
 
. : . : . : . : . : . :
rJMSF042N16+ CGCGCCTTCGTGGGCCTTGCCCCTTTCCATTCGCTCCTCTCTCATTTTTCTCCAGATTCT
rJMSF041N16+ CGCGCCTTCGTGGGCCTTGCCCCTTTCCATTCGCTCCTCTCTCATTTTTCTCCAGATTCT
JMSF041N16- CGCGCCTTCGTGGGCCTTGCCCCTTTCCATTCGCTCCTCTCTCATTTTTCTCCAGATTCT
JMSF042N16- CGCGCCTTCGTGGGCCTTGCCCCTTTCCATTCGCTCCTCTCTCATTTTTCTCCAGATTCT
                      ____________________________________________________________
consensus CGCGCCTTCGTGGGCCTTGCCCCTTTCCATTCGCTCCTCTCTCATTTTTCTCCAGATTCT
 
. : . : . : . : . : . :
rJMSF042N16+ ACAAGTTTCGAGCACACTTTCACCAAGATTGGCAATGGTTGCCGATTCTTTGCCATGAGA
rJMSF041N16+ ACAAGTTTCGAGCACACTTTCACCAAGATTGGCAATGGTTGCCGATTCTTTGCCATGAGA
JMSF041N16- ACAAGTTTCGAGCACACTTTCACCAAGATTGGCAATGGTTGCCGATTCTTTGCCATGAGA
JMSF042N16- ACAAGTTTCGAGCACACTTTCACCAAGATTGGCAATGGTTGCCGATTCTTTGCCATGAGA
                      ____________________________________________________________
consensus ACAAGTTTCGAGCACACTTTCACCAAGATTGGCAATGGTTGCCGATTCTTTGCCATGAGA
 
. : . : . : . : . : . :
rJMSF042N16+ CACGGCAGGAGGGTACCTAAACTGAATAGACCCCCCGACCAGCGAAAGGCGCTCTTGCGA
rJMSF041N16+ CACGGCAGGAGGGTACCTAAACTGAATAGACCCCCCGACCAGCGAAAGGCGCTCTTGCGA
JMSF041N16- CACGGCAGGAGGGTACCTAAACTGAATAGACCCCCCGACCAGCGAAAGGCGCTCTTGCGA
JMSF042N16- CACGGCAGGAGGGTACCTAAACTGAATAGACCCCCCGACCAGCGAAAGGCGCTCTTGCGA
                      ____________________________________________________________
consensus CACGGCAGGAGGGTACCTAAACTGAATAGACCCCCCGACCAGCGAAAGGCGCTCTTGCGA
 
. : . : . : . : . : . :
rJMSF042N16+ GGCCTCACAACTCAGCTTCTCAAGTATGGACGCATCAAGACGACTAGAGCGAGAGCAAGG
rJMSF041N16+ GGCCTCACAACTCAGCTTCTCAAGTATGGACGCATCAAGACGACTAGAGCGAGAGCAAGG
JMSF041N16- GGCCTCACAACTCAGCTTCTCAAGTATGGACGCATCAAGACGACTAGAGCGAGAGCAAGG
JMSF042N16- GGCCTCACAACTCAGCTTCTCAAGTATGGACGCATCAAGACGACTAGAGCGAGAGCAAGG
                      ____________________________________________________________
consensus GGCCTCACAACTCAGCTTCTCAAGTATGGACGCATCAAGACGACTAGAGCGAGAGCAAGG
 
. : . : . : . : . : . :
rJMSF042N16+ GCAATGAGAAAGTTTGTTGACAAAATGATCACATTGGCCAAGGAGGGCAGTCTTCACAAG
rJMSF041N16+ GCAATGAGAAAGTTTGTTGACAAAATGATCACATTGGCCAAGGAGGGCAGTCTTCACAAG
JMSF041N16- GCAATGAGAAAGTTTGTTGACAAAATGATCACATTGGCCAAGGAGGGCAGTCTTCACAAG
JMSF042N16- GCAATGAGAAAGTTTGTTGACAAAATGATCACATTGGCCAAGGAGGGCAGTCTTCACAAG
                      ____________________________________________________________
consensus GCAATGAGAAAGTTTGTTGACAAAATGATCACATTGGCCAAGGAGGGCAGTCTTCACAAG
 
. : . : . : . : . : . :
rJMSF042N16+ CGAAGGCAAGCCCTCGGCTTCATCTACGAGAAGCAAATCGTGCACGCTTTATTCGCCGAG
rJMSF041N16+ CGAAGGCAAGCCCTCGGCTTCATCTACGAGAAGCAAATCGTGCACGCTTTATTCGCCGAG
JMSF041N16- CGAAGGCAAGCCCTCGGCTTCATCTACGAGAAGCAAATCGTGCACGCTTTATTCGCCGAG
JMSF042N16- CGAAGGCAAGCCCTCGGCTTCATCTACGAGAAGCAAATCGTGCACGCTTTATTCGCCGAG
                      ____________________________________________________________
consensus CGAAGGCAAGCCCTCGGCTTCATCTACGAGAAGCAAATCGTGCACGCTTTATTCGCCGAG
 
. : . : . : . : . : . :
rJMSF042N16+ GTCCCAGAGAGGTACGGCGACAGAAATGGAGGGTACACCCGGATAATAAGAACGCTTCCT
rJMSF041N16+ GTCCCAGAGAGGTACGGCGACAGAAATGGAGGGTACACCCGGATAATAAGAACGCTTCCT
JMSF041N16- GTCCCAGAGAGGTACGGCGACAGAAATGGAGGGTACACCCGGATAATAAGAACGCTTCCT
JMSF042N16- GTCCCAGAGAGGTACGGCGACAGAAATGGAGGGTACACCCGGATAATAAGAACGCTTCCT
                      ____________________________________________________________
consensus GTCCCAGAGAGGTACGGCGACAGAAATGGAGGGTACACCCGGATAATAAGAACGCTTCCT
 
. : . : . : . : . : . :
rJMSF042N16+ CGGCGAGGGGACAATGCACCAATGGCTTATATTGAGCTTGTCTAGTGACCAACTGTTTGA
rJMSF041N16+ CGGCGAGGGGACAATGCACCAATGGCTTATATTGAGCTTGTCTAGTGACCAACTGTT
JMSF041N16- CGGCGAGGGGACAATGCACCAATGGCTTATATTGAGCTTGTCTAGTGACCAACTGTTTGA
JMSF042N16- CGGCGAGGGGACAATGCACCAATGGCTTATATTGAGCTTGTCTAGTGACCAACTGTTTGA
                      ____________________________________________________________
consensus CGGCGAGGGGACAATGCACCAATGGCTTATATTGAGCTTGTCTAGTGACCAACTGTTTGA
 
. : . : . : . : . : . :
rJMSF042N16+ TGTTGCATTTGATTTCT
JMSF041N16- TGTTGCATTTGATTTCTTGAGTTTAATGTTAACAAGAGATTTTGTTGGGCAAA
JMSF042N16- TGTTGCATTTGATTTCTTGAGTTTAATGTTAACAAGAGATTTTGTTGGGCAAAAAAAAAA
                      ____________________________________________________________
consensus TGTTGCATTTGATTTCTTGAGTTTAATGTTAACAAGAGATTTTGTTGGGCAAAAAAAAAA