Previous Contig 007514:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF033A08Sequence636007514 (2)gb:AY056391_15636997e-45Arabidopsis thaliana AT3g63200/F16M2_50 mRNA, complete cds.>gb:BT001015_1635270 699013442 (2)gb:AY056391_15636995e-71Arabidopsis thaliana AT3g63200/F16M2_50 mRNA, complete cds.>gb:BT001015_1635270
JMSF042N03Sequence776007514 (2)gb:AY056391_15636991e-44Arabidopsis thaliana AT3g63200/F16M2_50 mRNA, complete cds.>gb:BT001015_1635270 734013442 (2)gb:AY056391_15636992e-78Arabidopsis thaliana AT3g63200/F16M2_50 mRNA, complete cds.>gb:BT001015_1635270

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033A08+ TCCTCAAAGCCTCCTTCAACACCTTATCCATACTCTTCCCCGAAAATTTCCGCCG
JMSF042N03+ CTCCTCAAAGCCTCCTTCAACACCTTATCCATACTCTTCCCCGAAAATTTCCGCCG
                      ____________________________________________________________
consensus CTCCTCAAAGCCTCCTTCAACACCTTATCCATACTCTTCCCCGAAAATTTCCGCCG
 
. : . : . : . : . : . :
JMSF033A08+ CCTGCCAAAAACGCCGACGTGCTTCTTCTTGAACAGCTCCGGCTGCTTCTCTCTCACGAA
JMSF042N03+ CCTGCCAAAAACGCCGACGTGCTTCTTCTTGAACAGCTCCGGCTGCTTCTCTCTCACGAA
                      ____________________________________________________________
consensus CCTGCCAAAAACGCCGACGTGCTTCTTCTTGAACAGCTCCGGCTGCTTCTCTCTCACGAA
 
. : . : . : . : . : . :
JMSF033A08+ CGCGAAGGCCTCCTTCGCCGTATACAAAGGACGGCCGTTTCCTCCGTCGGCAGTCAACAT
JMSF042N03+ CGCGAAGGCCTCCTTCGCCGTATACAAAGGACGGCCGTTTCCTCCGTCGGCAGTCAACAT
                      ____________________________________________________________
consensus CGCGAAGGCCTCCTTCGCCGTATACAAAGGACGGCCGTTTCCTCCGTCGGCAGTCAACAT
 
. : . : . : . : . : . :
JMSF033A08+ TGTGGCGAAGATAGCACCTATTCCAGTACCGGCGATAACATCGAAGAAGTCGGCAATCCG
JMSF042N03+ TGTGGCGAAGATAGCACCTATTCCAGTACCGGCGATAACATCGAAGAAGTCGGCAATCCG
                      ____________________________________________________________
consensus TGTGGCGAAGATAGCACCTATTCCAGTACCGGCGATAACATCGAAGAAGTCGGCAATCCG
 
. : . : . : . : . : . :
JMSF033A08+ AGCATTAGGATCGCCGGTTTTCGCGCAGATCTGATCCTCTAGATGGATCAAAGCAGCAGC
JMSF042N03+ AGCATTAGGATCGCCGGTTTTCGCGCAGATCTGATCCTCTAGATGGATCAAAGCAGCAGC
                      ____________________________________________________________
consensus AGCATTAGGATCGCCGGTTTTCGCGCAGATCTGATCCTCTAGATGGATCAAAGCAGCAGC
 
. : . : . : . : . : . :
JMSF033A08+ GCAAACAATGCCGGTAGTTCCTCCGCCGTCGATGCAAAGAACACCCGTTTTCCTTCCTTC
JMSF042N03+ GCAAACAATGCCGGTAGTTCCTCCGCCGTCGATGCAAAGAACACCCGTTTTCCTTCCTTC
                      ____________________________________________________________
consensus GCAAACAATGCCGGTAGTTCCTCCGCCGTCGATGCAAAGAACACCCGTTTTCCTTCCTTC
 
. : . : . : . : . : . :
JMSF033A08+ GCAGTGGTAAAGCCATTTCTGCTCCAGCTTAGAGAAAATCTCCTGCGTCATCTTACTCAG
JMSF042N03+ GCAGTGGTAAAGCCATTTCTGCTCCAGCTTAGAGAAAATCTCCTGCGTCATCTTACTCAG
                      ____________________________________________________________
consensus GCAGTGGTAAAGCCATTTCTGCTCCAGCTTAGAGAAAATCTCCTGCGTCATCTTACTCAG
 
. : . : . : . : . : . :
JMSF033A08+ CTCCGACTCCATCATCCCTACCTTCAACACGACTTCAGAGAGAACAAAAAAACAGCAAAA
JMSF042N03+ CTCCGACTCCATCATCCCTACCTTCAACACGACTTCAGAGAGAACAAAAAAACAGCAAAA
                      ____________________________________________________________
consensus CTCCGACTCCATCATCCCTACCTTCAACACGACTTCAGAGAGAACAAAAAAACAGCAAAA
 
. : . : . : . : . : . :
JMSF033A08+ ACAAAAGACAATCTCAAATCTCAAATCTCAAGGCGAGTGTTACAGTGGGTGTTGTTGAAG
JMSF042N03+ ACAAAAGACAATCTCAAATCTCAAATCTCAAGGCGAGTGTTACAGTGGGTGTTGTTGAAG
                      ____________________________________________________________
consensus ACAAAAGACAATCTCAAATCTCAAATCTCAAGGCGAGTGTTACAGTGGGTGTTGTTGAAG
 
. : . : . : . : . : . :
JMSF033A08+ GCTATGAACTGCGAGTGTGTATAGAGAGGCATAGAGCATGGACTGGACTACTATAGGGTG
JMSF042N03+ GCTATGAACTGCGAGTGTGTATAGAGAGGCATAGAGCATGGACTGGACTACTATAGGGTG
                      ____________________________________________________________
consensus GCTATGAACTGCGAGTGTGTATAGAGAGGCATAGAGCATGGACTGGACTACTATAGGGTG
 
. : . : . : . : . : . :
JMSF033A08+ GTGCCGTACTGAAAGAAAATCCGTGAAACATGAAAAGTCC
JMSF042N03+ GTGCCGTACTGAAAGAAAATCCGTGAAACATGAAAAGTCCTCACGCTTTGTTTCTGAGAG
                      ____________________________________________________________
consensus GTGCCGTACTGAAAGAAAATCCGTGAAACATGAAAAGTCCTCACGCTTTGTTTCTGAGAG
 
. : . : . : . : . : . :
JMSF042N03+ GCATTTATGGCTCTTAGTTTCTCTCTCTCTCTCTCTCTCTCTTTCTCTCACAGTAACTGC
                      ____________________________________________________________
consensus GCATTTATGGCTCTTAGTTTCTCTCTCTCTCTCTCTCTCTCTTTCTCTCACAGTAACTGC
 
. : . : . : . : . : . :
JMSF042N03+ ATTCTATTTCTCTCTCTAACAGTCACACACAGAGTGTGTTGGAGAAGGTACAGAGAGGCC
                      ____________________________________________________________
consensus ATTCTATTTCTCTCTCTAACAGTCACACACAGAGTGTGTTGGAGAAGGTACAGAGAGGCC