Previous Contig 007509:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011B10Sequence603007509 (10)pir|T52336|T523361e-33probable type 1 membrane protein [imported] - Arabidopsis thaliana>gb:AB028621_1802007509 (10)pir|T52336|T523362e-22probable type 1 membrane protein [imported] - Arabidopsis thaliana>gb:AB028621_1
JMFF048C16Sequence407007509 (10)pir|T52336|T523366e-19probable type 1 membrane protein [imported] - Arabidopsis thaliana>gb:AB028621_1
JMFN009O18Sequence339007509 (10)pir|T52336|T523361e-16probable type 1 membrane protein [imported] - Arabidopsis thaliana>gb:AB028621_1
JMSF003H07Sequence396007509 (10)pir|T52336|T523366e-19probable type 1 membrane protein [imported] - Arabidopsis thaliana>gb:AB028621_1789007509 (10)pir|T52336|T523368e-26probable type 1 membrane protein [imported] - Arabidopsis thaliana>gb:AB028621_1
JMSF019C18Sequence497007509 (10)pir|T52336|T523365e-24probable type 1 membrane protein [imported] - Arabidopsis thaliana>gb:AB028621_1809007509 (10)pir|T52336|T523364e-27probable type 1 membrane protein [imported] - Arabidopsis thaliana>gb:AB028621_1
JMSF042L19Sequence762007509 (10)pir|T52336|T523363e-40probable type 1 membrane protein [imported] - Arabidopsis thaliana>gb:AB028621_1738007509 (10)pir|T52336|T523367e-22probable type 1 membrane protein [imported] - Arabidopsis thaliana>gb:AB028621_1

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042L19- ATCCATCTCCAATTTT
rJMFF011B10- TTGATTGAAAAAGGTATCCATCCATCTCCAATTTT
                      ____________________________________________________________
consensus TTGATTGAAAAAGGTATCCATCCATCTCCAATTTT
 
. : . : . : . : . : . :
rJMSF042L19- TAAAAAAATTATTTTGTTTCTAAATTACATTACAAAGACAATATAAATTTAAACCATAAG
rJMFF011B10- TAAAAAAATTATTTTGTTTCTAAATTACATTACAAAGACAATATAAATTTAAACCATAAG
rJMSF003H07- AAAAATTATTTTGTTTCT-AATTACATTACAAAGACAATATAAATTTAAACCATAAG
rJMSF019C18- AAAAATTATTTTGTTTCT-AATTACATTACAAAGACAATATAAATTTAAACCATAAG
                      ____________________________________________________________
consensus TAAAAAAATTATTTTGTTTCTAAATTACATTACAAAGACAATATAAATTTAAACCATAAG
 
. : . : . : . : . : . :
rJMSF042L19- CTAACTAATACGACACAACGGAGAAAAGGAAAACAATTGAGTTTCTCTCCTCTAACCTCT
rJMFF011B10- CTAACTAATACGACACAACGGAGAAAAGGAAAACAATTGAGTTTCTCTCCTCTAACCTCT
rJMSF003H07- CTAACTAATACGACACAACGGAGAAAAGGAAAACAATTGAGTTTCTCTCCTCTAACCTCT
rJMSF019C18- CTAACTAATACGACACAACGGAGAAAAGGAAAACAATTGAGTTTCTCTCCTCTAACCTCT
                      ____________________________________________________________
consensus CTAACTAATACGACACAACGGAGAAAAGGAAAACAATTGAGTTTCTCTCCTCTAACCTCT
 
. : . : . : . : . : . :
rJMSF042L19- TACCTCTTGCCAGTTGCCACCTACAACCTGATCAGAAACATTTATCACACGCCAACTTCC
rJMFF011B10- TACCTCTTGCCAGTTGCCACCTACAACCTGATCAGAAACATTTATCACACGCCAACTTCC
rJMSF003H07- TACCTCTTGCCAGTTGCCACCTACAACCTGATCAGAAACATTTATCACACGCCAACTTCC
rJMSF019C18- TACCTCTTGCCAGTTGCCACCTACAACCTGATCAGAAACATTTATCACACGCCAACTTCC
                      ____________________________________________________________
consensus TACCTCTTGCCAGTTGCCACCTACAACCTGATCAGAAACATTTATCACACGCCAACTTCC
 
. : . : . : . : . : . :
rJMSF042L19- CGGAAGTTTACAAGCATAATTAACCAGCCATCATTTTATTTTTAACAGTGATGGACATTT
rJMFF011B10- CGGAAGTTTACAAGCATAATTAACCAGCCATCATTTTATTTTTAACAGTGATGGACATTT
rJMSF003H07- CGGAAGTTTACAAGCATAATTAACCAGCCATCATTTTATTTTTAACAGTGATGGACATTT
rJMSF019C18- CGGAAGTTTACAAGCATAATTAACCAGCCATCATTTTATTTTTAACAGTGATGGACATTT
                      ____________________________________________________________
consensus CGGAAGTTTACAAGCATAATTAACCAGCCATCATTTTATTTTTAACAGTGATGGACATTT
 
. : . : . : . : . : . :
rJMSF042L19- CAAAGGAGAAATAGGAGTAACAGACGCATCACAAATATCTTATACCAGGGTTCTGACCAC
rJMFF011B10- CAAAGGAGAAATAGGAGTAACAGACGCATCACAAATATCTTATACCAGGGTTCTGACCAC
rJMSF003H07- CAAAGGAGAAATAGGAGTAACAGACGCATCACAAATATCTTATACCAGGGTTCTGACCAC
rJMSF019C18- CAAAGGAGAAATAGGAGTAACAGACGCATCACAAATATCTTATACCAGGGTTCTGACCAC
                      ____________________________________________________________
consensus CAAAGGAGAAATAGGAGTAACAGACGCATCACAAATATCTTATACCAGGGTTCTGACCAC
 
. : . : . : . : . : . :
rJMSF042L19- ATCTTCAATCTCCCAGTGATTGAATGCAGCACTGGTAAAACCTTAGTCGAGCTTGACATT
rJMFF011B10- ATCTTCAATCTCCCAGTGATTGAATGCAGCACTGGTAAAACCTTAGTCGAGCTTGACATT
rJMSF003H07- ATCTTCAATCTCCCAGTGATTGAATGCAGCACTGGTAAAACCTTAGTCGAGCTTGACATT
rJMSF019C18- ATCTTCAATCTCCCAGTGATTGAATGCAGCACTGGTAAAACCTTAGTCGAGCTTGACATT
                      ____________________________________________________________
consensus ATCTTCAATCTCCCAGTGATTGAATGCAGCACTGGTAAAACCTTAGTCGAGCTTGACATT
 
. : . : . : . : . : . :
rJMSF042L19- AGAATAGAGAAGTGTGTCCCTTGTGAGAGGCATGTTGAGAAGAAAGTAAATCCCTAAAAG
rJMFF011B10- AGAATAGAGAAGTGTGTCCCTTGTGAGAGGCATGTTGAGAAGAAAGTAAATCCCTAAAAG
rJMSF003H07- AGAATAGAGAAGTGTGTCCCTTGTGAGAGGCATGTTGAGAAGAAAGTAAATCCCTAAAAG
rJMSF019C18- AGAATAGAGAAGTGTGTCCCTTGTGAGAGGCATGTTGAGAAGAAAGTAAATCCCTAAAAG
                      ____________________________________________________________
consensus AGAATAGAGAAGTGTGTCCCTTGTGAGAGGCATGTTGAGAAGAAAGTAAATCCCTAAAAG
 
. : . : . : . : . : . :
rJMSF042L19- AGTTGCAATTATAAGCATGATTCCCGTGGTCCATGCTACTGTTTTTCTAACCAATTTCTC
rJMFF011B10- AGTTGCAATTATAAGCATGATTCCCGTGGTCCATGCTACTGTTTTTCTAACCAATTTCTC
rJMSF003H07- AGTTGCAATTATAAGCATGATTCCCGTGGTCCATGCTACTGTTTTTCTAACCAATTTCTC
rJMSF019C18- AGTTGCAATTATAAGCATGATTCCCGTGGTCCATGCTACTGTTTTTCTAACCAATTTCTC
                      ____________________________________________________________
consensus AGTTGCAATTATAAGCATGATTCCCGTGGTCCATGCTACTGTTTTTCTAACCAATTTCTC
 
. : . : . : . : . : . :
rJMSF042L19- AGCTTCTTTAGCAAGAGTGGCATTTTTTAAGGATTTTGTTTCCTCCAGCCAGCGTGCAGA
rJMFF011B10- AGCTTCTTTAGCAAGAGTGGCATTTTTTAAGGATTTTGTTTCCTCCAGCCAGCGTGCAGA
rJMSF003H07- AGCTTCTTTAGCAAGAGTGGCATTTTTTAAGGATTTTGTTTCCTCCAGCCAGCGTGCAGA
rJMSF019C18- AGCTTCTTTAGCAAGAGTGGCATTTTTTAAGGATTTTGTTTCCTCCAGCCAGCGTGCAGA
                      ____________________________________________________________
consensus AGCTTCTTTAGCAAGAGTGGCATTTTTTAAGGATTTTGTTTCCTCCAGCCAGCGTGCAGA
 
. : . : . : . : . : . :
rJMSF042L19- TGGTCGAGAATCAAAGATTAAGTTCAGCATTGGCTCAGATGCTGGGTTGCAGACAATGAC
rJMFF011B10- TGGTCGAGAATCAAAGATTAAGTTCAGCATTGGCTCAGATGCTGGATTGCAGACAATGAC
rJMSF003H07- TGGTCGAGAATCAAAGATTAAGTTCAGCATTGGCTCAGATGCTGGATTGCAGACAATGAC
rJMSF019C18- TGGTCGAGAATCAAAGATTAAGTTCAGCATTGGCTCAGATGCTGGATTGCAGACAATGAC
                      ____________________________________________________________
consensus TGGTCGAGAATCAAAGATTAAGTTCAGCATTGGCTCAGATGCTGGATTGCAGACAATGAC
 
. : . : . : . : . : . :
rJMSF042L19- TCCAACAATTTCACCTTTATATGCGCCACGTAATGAATTAAATATCTTCGAAATTACATG
rJMFF011B10- TCCAACAATTTCACCTTTATATGCGTCACGTAATGAATTAAATATCTTCGAAATTACATG
rJMSF003H07- TCCAACAATTTCACCTTTATATGCGTCACGTAATGAATTAAATATCTTCGAAATTACATG
rJMSF019C18- TCCAACAATTTCACCTTTATATGCGTCACGTAATGAATTAAATATCTTCGAAATTACATG
                      ____________________________________________________________
consensus TCCAACAATTTCACCTTTATATGCGTCACGTAATGAATTAAATATCTTCGAAATTACATG
 
. : . : . : . : . : . :
rJMSF042L19- AACAGACAATCTAACAGCATGTGCAACATTTTCTATTCCATCATTGCTTTTCATTGCCTC
rJMFF011B10- AACAGACAATCTAACAGCATGTGCAACATTTTCTATTCCATCATTGCTTTTCATTGCCTC
rJMSF003H07- AACAGACAATCTAACAGCATGTGCAACATTTTCTATTCCATCATTGCTTTTCATTGCCTC
rJMSF019C18- AACAGACAATCTAACAGCATGTGCAACATTTTCTATTCCATCATTGCTTTTCATTGCCTC
                      ____________________________________________________________
consensus AACAGACAATCTAACAGCATGTGCAACATTTTCTATTCCATCATTGCTTTTCATTGCCTC
 
. : . : . : . : . : . :
rJMSF042L19- AA
rJMFF011B10- AATGGCATTGGAATCTTCCAGTAATTAGCTCAGCTATACTTTTTTCA
rJMSF003H07- AATGGCATT-GAATCTTCCAGTAATTAGCTCAGCTATACTTTTTTCACTT-CNGACAAAT
rJMSF019C18- AATGGCATT-GAATCTTCCAGTAATTAGCTCAGCTATACTTTTTTCACTTCCAGACAAAT
JMSF042L19+ CAGTAATTAGCTCAGCTATACTTTTTTCACTTCCAGACAAAT
                      ____________________________________________________________
consensus AATGGCATT-GAATCTTCCAGTAATTAGCTCAGCTATACTTTTTTCACTTCCAGACAAAT
 
. : . : . : . : . : . :
rJMSF003H07- CANGATGCAGC
rJMSF019C18- CATGATGCAGCTCCNTTGCCTTTGGACTAT
JMSF042L19+ CATGATGCAGCTCCTTTGCCTTTTGACTATTGTAGGTGAGTAAGATAAGGCTTCTTATAA
                      ____________________________________________________________
consensus CATGATGCAGCTCCTTTGCCTTTTGACTATTGTAGGTGAGTAAGATAAGGCTTCTTATAA
 
. : . : . : . : . : . :
JMFF011B10+ CCAAAGGGA
JMSF042L19+ ACTCTTTCACTGCTGTTTTGGACAAGTCAAATTTTAATTCAGCTTCATTCTCCAAAGGGA
                      ____________________________________________________________
consensus ACTCTTTCACTGCTGTTTTGGACAAGTCAAATTTTAATTCAGCTTCATTCTCCAAAGGGA
 
. : . : . : . : . : . :
JMFF011B10+ TAGTCAGTTCCCCCATCAATGGTTCTCCAGCAACAGTAACATATGAGCCGCCCAGCCACG
JMSF042L19+ TAGTCAGTTCCCCCATCAATGGTTCTCCAGCAACAGTAACATATGAGCCGCCCAGCCACG
                      ____________________________________________________________
consensus TAGTCAGTTCCCCCATCAATGGTTCTCCAGCAACAGTAACATATGAGCCGCCCAGCCACG
 
. : . : . : . : . : . :
JMFN009O18+ TCTTTCTCCGATAATTCAGCCTCTGAATCCAAATTCAAGGGCT
JMFF011B10+ ATGCAAAATCACTTAGTTCTTTCTCCGATAATTCAGCCTCTGAATCCAAATTCAAGGGCT
JMSF019C18+ TCTGAATCCAAATTCAAGGGCT
JMSF042L19+ ATGCAAAATCACTTAGTTCTTTCTCCGATAATTCAGCCTCTGAATCCAAATTCAAGGGCT
                      ____________________________________________________________
consensus ATGCAAAATCACTTAGTTCTTTCTCCGATAATTCAGCCTCTGAATCCAAATTCAAGGGCT
 
. : . : . : . : . : . :
JMFN009O18+ CATTCAATGAGAGCACAGATACTTCCTCATCACCTGGAAGTTGAATGTCAGCATTATTTG
JMFF011B10+ CATTCAATGAGAGCACAGATACTTCCTCATCACCTGGAAGTTGAATGTCAGCATTATTTG
JMSF019C18+ CATTCAATGAGAGCACAGATACTTCCTCATCACCTGGAAGTTGAATGTCAGCATTATTTG
JMSF042L19+ CATTCAATGAGAGCACAGATACTTCCTCATCACCTGGAAGTTGAATGTCAGCATTATTTG
                      ____________________________________________________________
consensus CATTCAATGAGAGCACAGATACTTCCTCATCACCTGGAAGTTGAATGTCAGCATTATTTG
 
. : . : . : . : . : . :
JMFN009O18+ TATTGCCAAGAATGTCTCTCCTATGGGTGCCACTTAAGAACTCCTTTGTGCCATCCAAAA
JMFF011B10+ TATTGCCAAGAATGTCTCTCCTATGGGTGCCACTTAAGAACTCCTTTGTGCCATCCAAAA
JMSF019C18+ TATTGCCAAGAATGTCTCTCCTATGGGTGCCACTTAAGAACTCCTTTGTGCCATCCAAAA
JMFF048C16+ ATGTCTCTCCTATGGGTGCCACTTAAGAACTCCTTTGTGCCATCCAAAA
JMSF003H07+ CCTATGGGTGCCACTTAAGAACTCCTTTGTGCCATCCAAAA
JMSF042L19+ TATTGCCAAGAATGTCTCTCCTATGGGTGCCACTTAAGAACTCCTTTGTGCCATCCAAAA
                      ____________________________________________________________
consensus TATTGCCAAGAATGTCTCTCCTATGGGTGCCACTTAAGAACTCCTTTGTGCCATCCAAAA
 
. : . : . : . : . : . :
JMFN009O18+ ATTGCGACCCTTCAGCTCTGGTGACTTCTAGCAAAAAAACAGTGCGAGGTCTATCAAAGG
JMFF011B10+ ATTGCGACCCTTCAGCTCTGGTGACTTCTAGCAAAAAAACAGTGCGAGGTCTATCAAAGG
JMSF019C18+ ATTGCGACCCTTCAGCTCTGGTGACTTCTAGCAAAAAAACAGTGCGAGGTCTATCAAAGG
JMFF048C16+ ATTGCGACCCTTCAGCTCTGGTGACTTCTAGCAAAAAAACAGTGCGAGGTCTATCAAAGG
JMSF003H07+ ATTGCGACCCTTCAGCTCTGGTGACTTCTAGCAAAAAAACAGTGCGAGGTCTATCAAAGG
JMSF042L19+ ATTGCGACCCTTCAGCTCTGGTGACTTCTAGCAAAAAAACAGTGCGAGGTCTATCAAAGG
                      ____________________________________________________________
consensus ATTGCGACCCTTCAGCTCTGGTGACTTCTAGCAAAAAAACAGTGCGAGGTCTATCAAAGG
 
. : . : . : . : . : . :
JMFN009O18+ GATTAGGTGCAAGTACCTCATTTAACTTAAATGAACTCTCAGCTGAAAGGGTAGCTGGAG
JMFF011B10+ GATTAGGTGCAAGTACCTCATTTAACTTAAATGAACTCTCAGCTGAAAGGGTAGCTGGAG
JMSF019C18+ GATTAGGTGCAAGTACCTCATTTAACTTAAATGAACTCTCAGCTGAAAGGGTAGCTGGAG
JMFF048C16+ GATTAGGTGCAAGTACCTCATTTAACTTAAATGAACTCTCAGCTGAAAGGGTAGCTGGAG
JMSF003H07+ GATTAGGTGCAAGTACCTCATTTAACTTAAATGAACTCTCAGCTGAAAGGGTAGCTGGAG
JMSF042L19+ GATTAGGTGCAAGTACCTCATTTAACTTAAATGAACTCTCAGCTGAAAGGGTAGCTGGAG
                      ____________________________________________________________
consensus GATTAGGTGCAAGTACCTCATTTAACTTAAATGAACTCTCAGCTGAAAGGGTAGCTGGAG
 
. : . : . : . : . : . :
JMFN009O18+ GTGCAAAACCGAGTAAGACTGACACAGCAGCGCCTACTTCTGGAAGCGACAAGGAA
JMFF011B10+ GTGCAAAACCGAGTAAGACTGACACAGCAGCGCCTACTTCTGGAAGCGACAAGGAAGCAG
JMSF019C18+ GTGCAAAACCGAGTAAGACTGACACAGCAGCGCCTACTTCTGGAAGCGACAAGGAAGCAG
JMFF048C16+ GTGCAAAACCGAGTAAGACTGACACAGCAGCGCCTACTTCTGGAAGCGACAAGGAAGCAG
JMSF003H07+ GTGCAAAACCGAGTAAGACTGACACAGCAGCGCCTACTTCTGGAAGCGACAAGGAAGCAG
JMSF042L19+ GTGCAAAACCGAGTAAGACTGACACAGCAGCGCCTACTTCTGGAAGCGACAAGGAAGCAG
                      ____________________________________________________________
consensus GTGCAAAACCGAGTAAGACTGACACAGCAGCGCCTACTTCTGGAAGCGACAAGGAAGCAG
 
. : . : . : . : . : . :
JMFF011B10+ TCTCATCAGACGAAGACGGACGAACATATTGGTGAGCCGAACCATCGAGGAAGTAAACTC
JMSF019C18+ TCTCATCAGACGAAGACGGACGAACATATTGGTGAGCCGAACCATCGAGGAAGTAAACTC
JMFF048C16+ TCTCATCAGACGAAGACGGACGAACATATTGGTGAGCCGAACCATCGAGGAAGTAAACTC
JMSF003H07+ TCTCATCAGACGAAGACGGACGAACATATTGGTGAGCCGAACCATCGAGGAAGTAAACTC
JMSF042L19+ TCTCATCAGACGAAGACGGACGAACATATTGGTGAGCCGAACCATCGAGGAAGTAAACTC
                      ____________________________________________________________
consensus TCTCATCAGACGAAGACGGACGAACATATTGGTGAGCCGAACCATCGAGGAAGTAAACTC
 
. : . : . : . : . : . :
JMFF011B10+ CCGGGGCTCCATCGGTAACCGCGTAGTGGAGAGATAGAAGAGAGATGATGATTAGGTAGG
JMSF019C18+ CCGGGGCTCCATCGGTAACCGCGTAGTGGAGAGATAGAAGAGAGATGATGATTAGGTAGG
JMFF048C16+ CCGGGGCTCCATCGGTAACCGCGTAGTGGAGAGATAGAAGAGAGATGATGATTAGGTAGG
JMSF003H07+ CCGGGGCTCCATCGGTAACCGCGTAGTGGAGAGATAGAAGAGAGATGATGATTAGGTAGG
JMSF042L19+ CCGGGGCTCCATCGGTAACCGCGTAGTGGAGAGATAGAAGAGAGATGATGATTAGGTAGG
                      ____________________________________________________________
consensus CCGGGGCTCCATCGGTAACCGCGTAGTGGAGAGATAGAAGAGAGATGATGATTAGGTAGG
 
. : . : . : . : . : . :
JMFF011B10+ TGACAGAGGAACTTCTGCTCCGATCCATTGTTGAGCCTAGAGAGAGAGAGGG
JMSF019C18+ TGACAGAGGAACTTCTGCTCCGATCCATTGTTGAGCCTAGAGAGAGAGAGGG
JMFF048C16+ TGACAGAGGAACTTCTGCTCCGATCCATTGTTGAGCCTAGAGAGAGAGAGGG
JMSF003H07+ TGACAGAGGAACTTCTGCTCCGATCCATTGTTGAGCCTAGAGAGAGAGAGGG
JMSF042L19+ TGACAGAGGAACTTCTGCTCCGATCCATTGTTGAGCCTAGAGAGAGAGAGGGTTGATTTC
                      ____________________________________________________________
consensus TGACAGAGGAACTTCTGCTCCGATCCATTGTTGAGCCTAGAGAGAGAGAGGGTTGATTTC