Previous Contig 007505:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF042K18Sequence502007505 (2)gb:AP003989_18359853e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10455007505 (2)gb:AP003989_18359852e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042K18+ GAGGCAAGCCACGGAGAATCCGG
JMSF042K18- GAGGCAAGCCACGGAGAATCCGG
                      ____________________________________________________________
consensus GAGGCAAGCCACGGAGAATCCGG
 
. : . : . : . : . : . :
rJMSF042K18+ ATTCTTTCTGAAGCGAAAATGGTCTGCTTGGCATGTCTGTTACCGCTCTTCCTTGTTCCA
JMSF042K18- ATTCTTTCTGAAGCGAAAATGGTCTGCTTGGCATGTCTGTTACCGCTCTTCCTTGTTCCA
                      ____________________________________________________________
consensus ATTCTTTCTGAAGCGAAAATGGTCTGCTTGGCATGTCTGTTACCGCTCTTCCTTGTTCCA
 
. : . : . : . : . : . :
rJMSF042K18+ ATTGTCAACCTTTTGCCCCTTCTCTTCGATTTCTTCATGGCAAAGGTTTACAGATTATTT
JMSF042K18- ATTGTCAACCTTTTGCCCCTTCTCTTCGATTTCTTCATGGCAAAGGTTTACAGATTATTT
                      ____________________________________________________________
consensus ATTGTCAACCTTTTGCCCCTTCTCTTCGATTTCTTCATGGCAAAGGTTTACAGATTATTT
 
. : . : . : . : . : . :
rJMSF042K18+ GGGAAGGAGTATCAAAAACCTGCAAGGGTTCCTCCTGCTTGTCCGTATAAACCATCGGCC
JMSF042K18- GGGAAGGAGTATCAAAAACCTGCAAGGGTTCCTCCTGCTTGTCCGTATAAACCATCGGCC
                      ____________________________________________________________
consensus GGGAAGGAGTATCAAAAACCTGCAAGGGTTCCTCCTGCTTGTCCGTATAAACCATCGGCC
 
. : . : . : . : . : . :
rJMSF042K18+ ACCAAACCCAATAATTCAGTTTCAGAAGGACCTTCTCCTATAGACCAAGATCCTCACAGG
JMSF042K18- ACCAAACCCAATAATTCAGTTTCAGAAGGACCTTCTCCTATAGACCAAGATCCTCACAGG
                      ____________________________________________________________
consensus ACCAAACCCAATAATTCAGTTTCAGAAGGACCTTCTCCTATAGACCAAGATCCTCACAGG
 
. : . : . : . : . : . :
rJMSF042K18+ CAGATATCGGCTGGAGGTGATGATGGCAAGCGTGAATGAAAGTTTTACCATTTTATGTGA
JMSF042K18- CAGATATCGGCTGGAGGTGATGATGGCAAGCGTGAATGAAAGTTTTACCATTTTATGTGA
                      ____________________________________________________________
consensus CAGATATCGGCTGGAGGTGATGATGGCAAGCGTGAATGAAAGTTTTACCATTTTATGTGA
 
. : . : . : . : . : . :
rJMSF042K18+ AATTATATGATATATTTTCTTCTGTATGTTCATTTTCTATTGAACACAAGGGAAAAATAG
JMSF042K18- AATTATATGATATATTTTCTTCTGTATGTTCATTTTCTATTGAACACAAGGGAAAAATAG
                      ____________________________________________________________
consensus AATTATATGATATATTTTCTTCTGTATGTTCATTTTCTATTGAACACAAGGGAAAAATAG
 
. : . : . : . : . : . :
rJMSF042K18+ GTGTAAAAAGACAAAGTAAGATTTGTGCAANCATGATGTGTACTCTGTTAGTCTGAAAAA
JMSF042K18- GTGTAAAAAGACAAAGTAAGATTTGTGCAA-CATGATGTGTACTCTGTTAGTCTGAAAAA
                      ____________________________________________________________
consensus GTGTAAAAAGACAAAGTAAGATTTGTGCAANCATGATGTGTACTCTGTTAGTCTGAAAAA
 
. : . : . : . : . : . :
rJMSF042K18+ GCTACC
JMSF042K18- GCTACCTGATAACTTTGATTATAATAAGAATTGTACCCCAATCTTGAGCGAAAAAAAAAA
                      ____________________________________________________________
consensus GCTACCTGATAACTTTGATTATAATAAGAATTGTACCCCAATCTTGAGCGAAAAAAAAAA