Previous Contig 007495:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013D21Sequence528007495 (4)pir|T00440|T004402e-27hypothetical protein At2g47440 [imported] - Arabidopsis thaliana>gb:AC002535_153
JMFF039F09Sequence757007495 (4)pir|T00440|T004403e-56hypothetical protein At2g47440 [imported] - Arabidopsis thaliana>gb:AC002535_153
JMSF008H07Sequence397004994 (2)gb:BT004635_16376698e-16Arabidopsis thaliana At4g02100 gene, complete cds.441007495 (4)pir|T00440|T004405e-08hypothetical protein At2g47440 [imported] - Arabidopsis thaliana>gb:AC002535_153
JMSF042I12Sequence608007495 (4)pir|T00440|T004402e-18hypothetical protein At2g47440 [imported] - Arabidopsis thaliana>gb:AC002535_153337023990pir|T00440|T004400.019hypothetical protein At2g47440 [imported] - Arabidopsis thaliana>gb:AC002535_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF039F09+ CGGCAGA
                      ____________________________________________________________
consensus CGGCAGA
 
. : . : . : . : . : . :
rJMFF039F09+ ATGTTCAGTACAGGGAAATCCCGGGGAGGCTCTGCTCGCTCGCTACAAAGATTCAAGAAC
                      ____________________________________________________________
consensus ATGTTCAGTACAGGGAAATCCCGGGGAGGCTCTGCTCGCTCGCTACAAAGATTCAAGAAC
 
. : . : . : . : . : . :
rJMFF039F09+ TGAAGCAAAGGGTTGCCTCGGGTGAGACCGGGAATGTAGATTACTATTCCTTGATTGGAT
                      ____________________________________________________________
consensus TGAAGCAAAGGGTTGCCTCGGGTGAGACCGGGAATGTAGATTACTATTCCTTGATTGGAT
 
. : . : . : . : . : . :
rJMFF013D21+ TCAGAC
rJMFF039F09+ TAAGGCGAGGTTGTTCAAGATCAGAACTTGAAAGAGCCCATTTGCTGCTTACTCTCAGAC
                      ____________________________________________________________
consensus TAAGGCGAGGTTGTTCAAGATCAGAACTTGAAAGAGCCCATTTGCTGCTTACTCTCAGAC
 
. : . : . : . : . : . :
rJMFF013D21+ ATAAGCCTGATAAGTCCAGCAGCTTCATCGAGAGGTGCGAATATGCTGAGGAGCGCGATG
rJMFF039F09+ ATAAGCCTGATAAGTCCAGCAGCTTCATCGAGAGGTGCGAATATGCTGAGGAGCGCGATG
JMSF042I12- GCGCGATG
                      ____________________________________________________________
consensus ATAAGCCTGATAAGTCCAGCAGCTTCATCGAGAGGTGCGAATATGCTGAGGAGCGCGATG
 
. : . : . : . : . : . :
rJMFF013D21+ TTGAATCCGTGAGGGAGAGGGCGAAGATGTCTGCATTGTTGTTGTATAGATTAATTCAGA
rJMFF039F09+ TTGAATCCGTGAGGGAGAGGGCGAAGATGTCTGCATTGTTGTTGTATAGATTAATTCAGA
rJMSF008H07+ TTGTTGTTGTATAGATTAATTCNGN
JMSF042I12- TTGAATCCGTGAGGGAGAGGGCGAAGATGTCTGCATTGTTGTTGTATAGATTAATTCAGA
                      ____________________________________________________________
consensus TTGAATCCGTGAGGGAGAGGGCGAAGATGTCTGCATTGTTGTTGTATAGATTAATTCAGA
 
. : . : . : . : . : . :
rJMFF013D21+ GGGGTTATACGAGCTTAATGACAACCATCATTGATGAAGAAGCTGCCGAGAAGCAGAGGA
rJMFF039F09+ GGGGTTATACGAGCTTAATGACAACCATCATTGATGAAGAAGCTGCCGAGAAGCAGAGGA
rJMSF008H07+ GGGGTTNTACGNGCTTAATGNCNACCCTCNTTGATGAAGAAGCNGCCGAGAAGCNGAGGA
JMSF042I12- GGGGTTATACGAGCTTAATGACAACCATCATTGATGAAGAAGCTGCCGAGAAGCAGAGGA
                      ____________________________________________________________
consensus GGGGTTATACGAGCTTAATGACAACCATCATTGATGAAGAAGCTGCCGAGAAGCAGAGGA
 
. : . : . : . : . : . :
rJMFF013D21+ AGAAGGCTGCGGCTGCATTGCAAGCAATGCAACAAGAGGTTCAACAAGAATCCAAAATCA
rJMFF039F09+ AGAAGGCTGCGGCTGCATTGCAAGCAATGCAACAAGAGGTTCAACAAGAATCCAAAATCA
rJMSF008H07+ ANAAGGCTGCGGCTGCNTTGCAAGCAATGCAACAAGNGGTTCAACNAGAATCCAAAATCA
JMSF042I12- AGAAGGCTGCGGCTGCATTGCAAGCAATGCAACAAGAGGTTCAACAAGAATCCAAAATCA
                      ____________________________________________________________
consensus AGAAGGCTGCGGCTGCATTGCAAGCAATGCAACAAGAGGTTCAACAAGAATCCAAAATCA
 
. : . : . : . : . : . :
rJMFF013D21+ AACCAATTAGCAGTTCTGAATCCTCTGTTAGGATTGAAAACAATGGTACAGCCACCACGC
rJMFF039F09+ AACCAATTAGCAGTTCTGAATCCTCTGTTAGGATTGAAAACAATGGTACAGCCACCACGC
rJMSF008H07+ AACCNATTAGCNGTTTTGAATCCTNTGTTAGGNTTGAAAACAATGGTACNGCCCCCCCNC
JMSF042I12- AACCAATTAGCAGTTCTGAATCCTCTGTTAGGATTGAAAACAATGGTACAGCCACCACGC
                      ____________________________________________________________
consensus AACCAATTAGCAGTTCTGAATCCTCTGTTAGGATTGAAAACAATGGTACAGCCACCACGC
 
. : . : . : . : . : . :
rJMFF013D21+ CCCCAGGATCAGTGTTTCAAGGCGTGTTCTGCCGAGACCTTGCAATTGTCGGGAATTTGC
rJMFF039F09+ CCCCAGGATCAGTGTTTCAAGGCGTGTTCTGCCGAGACCTTGCAATTGTCGGGAATTTGC
rJMSF008H07+ CCCCNGGATCAGNGTTTCAAGGNGNGTTNTGCCGNGACCNTGCAATTGTCGGGAATTTGC
JMSF042I12- CCCCAGGATCAGTGTTTCAAGGCGTGTTCTGCCGAGACCTTGCAATTGTCGGGAATTTGC
                      ____________________________________________________________
consensus CCCCAGGATCAGTGTTTCAAGGCGTGTTCTGCCGAGACCTTGCAATTGTCGGGAATTTGC
 
. : . : . : . : . : . :
rJMFF013D21+ TATCTCAATCAGGGTTTAATCGTCCGCTCCCTGTGAAATACGAGGCGTTGAGCTGTTGAT
rJMFF039F09+ TATCTCAATCAGGGTTTAATCGTCCGCTCCCTGTGAAATACGAGGCGTTGAGCTGTTGAT
rJMSF008H07+ TATNTCNATCNGGGNTTAATNGTCCNCTCCCTGNGAAATACGNGGCGTTGAGCTGTTGAT
JMSF042I12- TATCTCAATCAGGGTTTAATCGTCCGCTCCCTGTGAAATACGAGGCGTTGAGCTGTTGAT
                      ____________________________________________________________
consensus TATCTCAATCAGGGTTTAATCGTCCGCTCCCTGTGAAATACGAGGCGTTGAGCTGTTGAT
 
. : . : . : . : . : . :
rJMFF013D21+ TGAGATTTTTCTGGTGGTGGATAAGCAAAGAATCTCATGATCAATCTGGTGGAAAGTTTC
rJMFF039F09+ TGAGATTTTTCTGGTGGTGGATAAGCAAAGAATCTCATGATCAATCTGGTGGAAAGTTTC
rJMSF008H07+ TGNGATTTTTNTGGGGGGGGNTAAGCAAAGAATNTCNTGATCAATNTGGGGGAAAGNTTC
JMSF042I12- TGAGATTTTTCTGGTGGTGGATAAGCAAAGAATCTCATGATCAATCTGGTGGAAAGTTTC
                      ____________________________________________________________
consensus TGAGATTTTTCTGGTGGTGGATAAGCAAAGAATCTCATGATCAATCTGGTGGAAAGTTTC
 
. : . : . : . : . : . :
rJMFF013D21+ TTTATTTCTTTCTTTCTTTCATGTGTTAATGTTCTTCAACTG
rJMFF039F09+ TTTATTTCTTTCTTTCTTTCATGTGTTAATGTTCTTCAACTGTTGGAGAATCTGATTCTG
rJMSF008H07+ TTTATTTCTTTCTTTNTTTCANGGGTTAATGTTNTTCAACTGTTGGNGAAT
JMSF042I12- TTTATTTCTTTCTTTCTTTCATGTGTTAATGTTCTTCAACTGTTGGAGAATCTGATTCTG
                      ____________________________________________________________
consensus TTTATTTCTTTCTTTCTTTCATGTGTTAATGTTCTTCAACTGTTGGAGAATCTGATTCTG
 
. : . : . : . : . : . :
rJMFF039F09+ GAACAAAGACTGTACAAATGGCAAAAAAT
JMSF042I12- GAACAAAGACTGTACAAATGGCAAAAAATGCTCTACTTTGCCATCCAGGAAAATTTTGTT
                      ____________________________________________________________
consensus GAACAAAGACTGTACAAATGGCAAAAAATGCTCTACTTTGCCATCCAGGAAAATTTTGTT
 
. : . : . : . : . : . :
JMSF042I12- ACCTACTGCAGTAGTATCTTTCTTCTGTAATTTTTTTTTTTTTTTTTTNAACCTTTTNGT
                      ____________________________________________________________
consensus ACCTACTGCAGTAGTATCTTTCTTCTGTAATTTTTTTTTTTTTTTTTTNAACCTTTTNGT