Previous Contig 007491:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007N07Sequence247007491 (2)gb:AP006175_18613920.002Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P066794013415 (2)gb:AP006175_18613921e-63Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P066
JMSF042H05Sequence778007491 (2)gb:AP006175_18613927e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P066810013415 (2)gb:AP006175_18613922e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P066

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042H05+ TGCTCCATCAAACCATATTTCTCTAACACTTCCATAATTTTTGAGAAGTTCTTGTAAT
                      ____________________________________________________________
consensus TGCTCCATCAAACCATATTTCTCTAACACTTCCATAATTTTTGAGAAGTTCTTGTAAT
 
. : . : . : . : . : . :
JMSF042H05+ TGAGCCAAGTAGTATTCATTGTAGGCCTTTGTCCGCCCGTATCTATGATCGTGGCGATCC
                      ____________________________________________________________
consensus TGAGCCAAGTAGTATTCATTGTAGGCCTTTGTCCGCCCGTATCTATGATCGTGGCGATCC
 
. : . : . : . : . : . :
JMSF042H05+ CAAGGGGAAAGGTACAAGCCGATATCGACACCGCGAGCCTTAGCGGCGTTAACAAGCTCC
                      ____________________________________________________________
consensus CAAGGGGAAAGGTACAAGCCGATATCGACACCGCGAGCCTTAGCGGCGTTAACAAGCTCC
 
. : . : . : . : . : . :
JMSF042H05+ CGGACAACGTCACCCTTCCCGTTCCTCCATGGGCTTCCGATGACGGAATGATCAGTGTAT
                      ____________________________________________________________
consensus CGGACAACGTCACCCTTCCCGTTCCTCCATGGGCTTCCGATGACGGAATGATCAGTGTAT
 
. : . : . : . : . : . :
JMSF042H05+ TTGGATGGCCAGAGGCAAAACCCATCGTGATGTTTAGCGGTGAGGATCATGAGAGAAATT
                      ____________________________________________________________
consensus TTGGATGGCCAGAGGCAAAACCCATCGTGATGTTTAGCGGTGAGGATCATGAGAGAAATT
 
. : . : . : . : . : . :
JMSF042H05+ CCGGCCTGGACCGCCGTCTCCACCCATTGGTTAGCGTCTAGAGAGGTTGGGTTGAAGATG
                      ____________________________________________________________
consensus CCGGCCTGGACCGCCGTCTCCACCCATTGGTTAGCGTCTAGAGAGGTTGGGTTGAAGATG
 
. : . : . : . : . : . :
JMSF007N07+ TGTGAAAGTGTTGACGCCAAAGTGA
JMSF042H05+ GCCGGATTCTCGTCGCCGGTGCCCCATTCCCGGTCTGTGAAAGTGTTGACGCCAAAGTGA
                      ____________________________________________________________
consensus GCCGGATTCTCGTCGCCGGTGCCCCATTCCCGGTCTGTGAAAGTGTTGACGCCAAAGTGA
 
. : . : . : . : . : . :
JMSF007N07+ TGGAACATGATGACTTCCCTCTGTTGCCATTTGAGTTGAGAAAAAGTTGGGAGGGGAAGG
JMSF042H05+ TGGAACATGATGACTTCCCTCTGTTGCCATTTGAGTTGAGAAAAAGTTGGGAGGGGAAGG
                      ____________________________________________________________
consensus TGGAACATGATGACTTCCCTCTGTTGCCATTTGAGTTGAGAAAAAGTTGGGAGGGGAAGG
 
. : . : . : . : . : . :
JMSF007N07+ ATGGGCAATGGGGGTGGTGTGACTGTCACTTGTGGCGGCGTTAATGAAGAAGAATTTGAT
JMSF042H05+ ATGGGCAATGGGGGTGGTGTGACTGTCACTTGTGGCGGCGTTAATGAAGAAGAATTTGAT
                      ____________________________________________________________
consensus ATGGGCAATGGGGGTGGTGTGACTGTCACTTGTGGCGGCGTTAATGAAGAAGAATTTGAT
 
. : . : . : . : . : . :
JMSF007N07+ ATGGAAATTTGTGTTAGTATGAAGAGCATGATGATTTTACACAAACTTTTGGTCTTTGCC
JMSF042H05+ ATGGAAATTTGTGTTAGTATGAAGAGCATGATGATTTTACACAAACTTTTGGTCTTTGCC
                      ____________________________________________________________
consensus ATGGAAATTTGTGTTAGTATGAAGAGCATGATGATTTTACACAAACTTTTGGTCTTTGCC
 
. : . : . : . : . : . :
JMSF007N07+ ATTATCAATTACTTGTGAGCTAACTACACTGTGTACACCT
JMSF042H05+ ATTATCAATTACTTGTGAGCTAACTACACTGTGTACACCTGCTCTTTATAACATAACATC
                      ____________________________________________________________
consensus ATTATCAATTACTTGTGAGCTAACTACACTGTGTACACCTGCTCTTTATAACATAACATC
 
. : . : . : . : . : . :
JMSF042H05+ AAACAAACATACCTACATACATACATGTATAATCTTGTAGCGTATGTTGGCGCACGTTGC
                      ____________________________________________________________
consensus AAACAAACATACCTACATACATACATGTATAATCTTGTAGCGTATGTTGGCGCACGTTGC
 
. : . : . : . : . : . :
JMSF042H05+ ACACTCACTATAATTCTTTTAGTTTTCTAGGAATATGTTAGGCGTTAGCCATCCTAGCCC
                      ____________________________________________________________
consensus ACACTCACTATAATTCTTTTAGTTTTCTAGGAATATGTTAGGCGTTAGCCATCCTAGCCC