Previous Contig 007489:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS070D11Sequence619007489 (9)gb:AY062680_15653362e-40Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMFS103A09Sequence556007489 (9)gb:AY062680_15653361e-46Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMFS158B10Sequence515007489 (9)gb:AY062680_15653361e-28Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMFS159H01Sequence626007489 (9)gb:AY062680_15653369e-47Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMFS159H02Sequence225007489 (9)gb:AY062680_15653364e-06Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMSF015A20Sequence230007489 (9)gb:AY062680_15653360.031Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.751013408 (3)gb:AY062680_1565336e-100Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMSF025H12Sequence690007489 (9)gb:AY062680_15653363e-33Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.773013408 (3)gb:AY062680_1565336e-103Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMSF034I24Sequence661007489 (9)gb:AY062680_15653362e-53Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMSF042F16Sequence766007489 (9)gb:AY062680_15653362e-41Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.512013408 (3)gb:AY062680_15653361e-51Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034I24+ CCCTTCCAGACTGCAATTCGATAGATA
                      ____________________________________________________________
consensus CCCTTCCAGACTGCAATTCGATAGATA
 
. : . : . : . : . : . :
JMFS103A09+ CACTTCCGGGAACAGAGTCTTCTCGAACGG
JMSF034I24+ CAGCCAATTGAAACGAGTAAGCTTCGTAATCACTTCCGGGAACAGAGTCTTCTCGAACGG
JMFS159H01+ TGAAACGAGTAAGCTTCGTAATCACTCCCGGGAACAGAGTCTTCTCGAACGG
                      ____________________________________________________________
consensus CAGCCAATTGAAACGAGTAAGCTTCGTAATCACTTCCGGGAACAGAGTCTTCTCGAACGG
 
. : . : . : . : . : . :
JMFS103A09+ ATTATCCCCGATGCTAAGAACCTCCAGCTTCGTAACATTTTCAAGCGAATTCCACGGAAA
JMSF034I24+ ATTATCCCCGATGCTAAGAACCTCCAGCTTCGTAACATTTTCAAGCGAATTCCACGGAAA
JMFS159H01+ ATTATCCCCGATGCTAAGAACCTCCAGCTTCGTAACATTTTCAAGCGAATTCCACGGAAA
JMFS070D11+ AGCTTCGTAACATTTTCAAGCGAATTCCACGGAAA
JMSF042F16+ CTAAGAACCTCCAGCTTCGTAACATTTTCAAGCGAATTCCACGGAAA
                      ____________________________________________________________
consensus ATTATCCCCGATGCTAAGAACCTCCAGCTTCGTAACATTTTCAAGCGAATTCCACGGAAA
 
. : . : . : . : . : . :
JMFS103A09+ TTTCCCGGAAAATCCGCTGCGATTCATGTACAGATGTGTCAACTCACTGAGCGCCGACAT
JMSF034I24+ TTTCCCGGAAAATCCGCTGCGATTCATGTACAGATGTGTCAACTCACTGAGCGCCGACAT
JMFS159H01+ TTTCCCGGAAAATCCGCTGCGATTCATGTACAGATGTGTCAACTCACTGAGCGCCGACAT
JMSF025H12+ CTGCGATTCATGTACAGATGTGTCAACTCACTGAGCGCCGACAT
JMFS070D11+ TTTCCCGGAAAATCCGCTGCGATTCATGTACAGATGTGTCAACTCACTGAGCGCCGACAT
JMSF042F16+ TTTCCCGGAAAATCCGCTGCGATTCATGTACAGATGTGTCAACTCACTGAGCGCCGACAT
                      ____________________________________________________________
consensus TTTCCCGGAAAATCCGCTGCGATTCATGTACAGATGTGTCAACTCACTGAGCGCCGACAT
 
. : . : . : . : . : . :
JMFS103A09+ GTCGGGAATCGACCCGGAGAAAAAATTGTTCCCGAGATCCAAATACTTTAGACCAACGCA
JMSF034I24+ GTCGGGAATCGACCCGGAGAAAAAATTGTTCCCGAGATCCAAATACTTTAGACCAACGCA
JMFS159H01+ GTCGGGAATCGACCCGGAGAAAAAATTGTTCCCGAGATCCAAATACTTTAGACCAACGCA
JMFS158B10+ AAAATTGTTCCCGAGATCCAAATACTTTAGACCAACGCA
JMSF025H12+ GTCGGGAATCGACCCGGAGAAAAAATTGTTCCCGAGATCCAAATACTTTAGACCAACGCA
JMFS070D11+ GTCGGGAATCGACCCGGAGAAAAAATTGTTCCCGAGATCCAAATACTTTAGACCAACGCA
JMSF042F16+ GTCGGGAATCGACCCGGAGAAAAAATTGTTCCCGAGATCCAAATACTTTAGACCAACGCA
                      ____________________________________________________________
consensus GTCGGGAATCGACCCGGAGAAAAAATTGTTCCCGAGATCCAAATACTTTAGACCAACGCA
 
. : . : . : . : . : . :
JMFS103A09+ TTTATTCAGTTCGTCGGAGAGCCGGCCGGAAAGTGAGTTGTGCCCGAGAGCCAGCTTCTC
JMSF034I24+ TTTATTCAGTTCGTCGGAGAGCCGGCCGGAAAGTGAGTTGTGCCCGAGAGCCAGCTTCTC
JMFS159H01+ TTTATTCAGTTCGTCGGAGAGCCGGCCGGAAAGTGAGTTGTGCCCGAGAGCCAGCTTCTC
JMFS158B10+ TTTATTCAGTTCGTCGGAGAGCCGGCCGGAAAGTGAGTTGTGCCCGAGAGCCAGCTTCTC
JMSF025H12+ TTTATTCAGTTCGTCGGAGAGCCGGCCGGAAAGTGAGTTGTGCCCGAGAGCCAGCTTCTC
JMFS070D11+ TTTATTCAGTTCGTCGGAGAGCCGGCCGGAAAGTGAGTTGTGCCCGAGAGCCAGCTTCTC
JMSF042F16+ TTTATTCAGTTCGTCGGAGAGCCGGCCGGAAAGTGAGTTGTGCCCGAGAGCCAGCTTCTC
                      ____________________________________________________________
consensus TTTATTCAGTTCGTCGGAGAGCCGGCCGGAAAGTGAGTTGTGCCCGAGAGCCAGCTTCTC
 
. : . : . : . : . : . :
JMFS103A09+ CAAAGAGCCCAGAGAGCAAATTGAATCAAATGGAATAGACCCGAACAGGCCTTGGCCGGA
JMSF034I24+ CAAAGAGCCCAGAGAGCAAATTGAATCAAATGGAATAGACCCGAACAGGCCTTGGCCGGA
JMFS159H01+ CAAAGAGCCCAGAGAGCAAATTGAATCAAATGGAATAGACCCGAACAGGCCTTGGCCGGA
JMFS158B10+ CAAAGAGCCCAGAGAGCAAATTGAATCAAATGGAATAGACCCGAACAGGCCTTGGCCGGA
JMSF025H12+ CAAAGAGCCCAGAGAGCAAATTGAATCAAATGGAATAGACCCGAACAGGCCTTGGCCGGA
JMFS070D11+ CAAAGAGCCCAGAGAGCAAATTGAATCAAATGGAATAGACCCGAACAGGCCTTGGCCGGA
JMSF042F16+ CAAAGAGCCCAGAGAGCAAATTGAATCAAATGGAATAGACCCGAACAGGCCTTGGCCGGA
                      ____________________________________________________________
consensus CAAAGAGCCCAGAGAGCAAATTGAATCAAATGGAATAGACCCGAACAGGCCTTGGCCGGA
 
. : . : . : . : . : . :
JMFS103A09+ AAGCTCGATCTCTCTGACTGAACCATCGGAGTTGCAGGTAATTCCGGCGAAAGTACAGAG
JMSF034I24+ AAGCTCGATCTCTCTGACTGAACCATCGGAGTTGCAGGTAATTCCGGCGAAAGTACAGAG
JMFS159H01+ AAGCTCGATCTCTCTGACTGAACCATCGGAGTTGCAGGTAATTCCGGCGAAAGTACAGAG
JMFS158B10+ AAGCTCGATCTCTCTGACTGAACCATCGGAGTTGCAGGTAATTCCGGCGAAAGTACAGAG
JMSF025H12+ AAGCTCGATCTCTCTGACTGAACCATCGGAGTTGCAGGTAATTCCGGCGAAAGTACAGAG
JMSF015A20+ GGTAATTCCGGCGAAAGTACAGAG
JMFS159H02+ CTCGATCTCTCTGACTGAACCATCGGAGTTGCAGGTAATTCCGGCGAAAGTACAGAG
JMFS070D11+ AAGCTCGATCTCTCTGACTGAACCATCGGAGTTGCAGGTAATTCCGGCGAAAGTACAGAG
JMSF042F16+ AAGCTCGATCTCTCTGACTGAACCATCGGAGTTGCAGGTAATTCCGGCGAAAGTACAGAG
                      ____________________________________________________________
consensus AAGCTCGATCTCTCTGACTGAACCATCGGAGTTGCAGGTAATTCCGGCGAAAGTACAGAG
 
. : . : . : . : . : . :
JMFS103A09+ CGGGGTACTAGAATTCCAGTTATCGAACACGCTGTTTCCGGCGTTCTGGAAGGAGGCCTT
JMSF034I24+ CGGGGTACTAGAATTCCAGTTATCGAACACGCTGTTTCCGGCGTTCTGGAAGGAGGCCTT
JMFS159H01+ CGGGGTACTAGAATTCCAGTTATCGAACACCCCGTTTCCGGCGTTCTGGAAGGAGGCCTT
JMFS158B10+ CGGGGTACTAGAATTCCAGTTATCGAACACGCTGTTTCCGGCGTTCTGGAAGGAGGCCTT
JMSF025H12+ CGGGGTACTAGAATTCCAGTTATCGAACACGCTGTTTCCGGCGTTCTGGAAGGAGGCCTT
JMSF015A20+ CGGGGTACTAGAATTCCAGTTATCGAACACGCTGTTTCCGGCGTTCTGGAAGGAGGCCTT
JMFS159H02+ CGGGGTACTAGAATTCCAGTTATCGAACACCCTGTTTCCGGCGTTCTGGAAGGAGGCCTT
JMFS070D11+ CGGGGTACTAGAATTCCAGTTATCGAACACGCTGTTTCCGGCGTTCTGGAAGGAGGCCTT
JMSF042F16+ CGGGGTACTAGAATTCCAGTTATCGAACACGCTGTTTCCGGCGTTCTGGAAGGAGGCCTT
                      ____________________________________________________________
consensus CGGGGTACTAGAATTCCAGTTATCGAACACGCTGTTTCCGGCGTTCTGGAAGGAGGCCTT
 
. : . : . : . : . : . :
JMFS103A09+ TAACGTTAGAAGCGATTGGAGCTCGTCGGAGCTGGCAACGAAGAAGAATAAGGTA-AAGA
JMSF034I24+ TAACGTTAGAAGCGATTGGAGCTCGTCGGAGCTGGCAACGAAGAAGAATAAGGTA-AAGA
JMFS159H01+ TAACGTTAGAAGCGATTGGAGCTCGTCGGAGCTGGCAACGAAGAAGAATAAGGTA-AAGA
JMFS158B10+ TAACGTTAGAAGCGATTGGAGCTCGTCGGAGCTGGCAACGAAGAAGAATAAGGCACAAGA
JMSF025H12+ TAACGTTAGAAGCGATTGGAGCTCGTCGGAGCTGGCAACGAAGAAGAATAAGGTA-AAGA
JMSF015A20+ TAACGTTAGAAGCGATTGGAGCTCGTCGGAGCTGGCAACGAAGAAGAATAAGGTA-AAGA
JMFS159H02+ TAACGTTAGAAGCGATTGGAGCTGGTCGGAGCTGGCAACGAAGAAGAATAAGGTA-AAGA
JMFS070D11+ TAACGTTAGAAGCGATTGGAGCTCGTCGGAGCTGGCAACGAAGAAGAATAAGGTA-AAGA
JMSF042F16+ TAACGTTAGAAGCGATTGGAGCTCGTCGGAGCTGGCAAAGAAGAAGAATAAGGTA-AAGA
                      ____________________________________________________________
consensus TAACGTTAGAAGCGATTGGAGCTCGTCGGAGCTGGCAACGAAGAAGAATAAGGTA-AAGA
 
. : . : . : . : . : . :
JMFS103A09+ AAGATAGGAGAGAAAGATTTGGCCGGAAAAGTTCACCCGCCGCCATC
JMSF034I24+ AAGATAGGAGAGAAAGATTTGGCCGGAAAAGTTCACCCGCCGCCATCTCTGACGGTTTAG
JMFS159H01+ AAGATAGGAGAGAAAGATTTGGCCGGAAAAGTTCACCCGCCGCCATCTCTGACGGTTTAG
JMFS158B10+ AAGATAGGAGAGAAAGATTTGGCCGGAAAAGTTCACCCGCCGCCATCTCTGACGGTTTAG
JMSF025H12+ AAGATAGGAGAGAAAGATTTGGCCGGAAAAGTTCACCCGCCGCCATCTCTGACGGTTTAG
JMSF015A20+ AAGATAGGAGAGAAAGATTTGGCCGGAAAAGTTCACCCGCCGCCATCTCTGACGGTTTAG
JMFS159H02+ AAGATAGGAGAGAAAGATTTGGCCGGAAAAGTTCACCCGCCGCCATCTC
JMFS070D11+ AAGATAGGAGAGAAAGATTTGGCCGGAAAAGTTCACCCGCCGCCATCTCTGACGGTTTAG
JMSF042F16+ AAGATAGGAGAGAAAGATTTGGCCGGAAAAGTTCACCCGCCGCCATCTCTGACGGTTTAG
                      ____________________________________________________________
consensus AAGATAGGAGAGAAAGATTTGGCCGGAAAAGTTCACCCGCCGCCATCTCTGACGGTTTAG
 
. : . : . : . : . : . :
JMSF034I24+ TTTGACGAGTAGAGAAAACTTGGTCTTCGGAGT
JMFS159H01+ TTTCACCAGTACAGAAAACTTGGTCTTCGGAGTGT
JMFS158B10+ TTTGACGAGTAGAGAAAACTTGGTCTTCGGAGTGTGGAAAAGACGGGCTAGAAGAAACCC
JMSF025H12+ TTTGACGAGTAGAGAAAACTTGGTCTTCGGAGTGTGGAAAAGACGGGCTAGAAGAAACCC
JMSF015A20+ TTTGACGAGTAGAGAAAACTTGG
JMFS070D11+ TTTGACGAGTAGAGAAAACTTGGTCTTCGGAGTGTGGAAAAGACGGGCTAGAAGAAACCC
JMSF042F16+ TTTGACGAGTAGAGAAAACTTGGTCTTCGGAGTGTGGAAAAGACGGGCTAGAAGAAACCC
                      ____________________________________________________________
consensus TTTGACGAGTAGAGAAAACTTGGTCTTCGGAGTGTGGAAAAGACGGGCTAGAAGAAACCC
 
. : . : . : . : . : . :
JMFS158B10+ AAATTGAGAACGGTGCAGATCATACTCCCATTTCCTTTCACTTTCCTCAGTAATTT
JMSF025H12+ AAATTGAGAACGGTGCAGATCATACTCCCATTTCCTTTCACTTTCCTCAGTAATTTTCAT
JMFS070D11+ AAATTGAGAACGGTGCAGATCATACTCCCATTTCCTTTCACTTTC
JMSF042F16+ AAATTGAGAACGGTGCAGATCATACTCCCATTTCCTTTCACTTTCCTCAGTAATTTTCAT
                      ____________________________________________________________
consensus AAATTGAGAACGGTGCAGATCATACTCCCATTTCCTTTCACTTTCCTCAGTAATTTTCAT
 
. : . : . : . : . : . :
JMSF025H12+ GTGAAGAAATCCCATGGCTGCTGTCGGCCGGTGGTTGAGAAGACTAGAAGAGAAAACCAA
JMSF042F16+ GTGAAGAAATCCCATGGCTGCTGTCGGCCGGTGGTTGAGAAGACTAGAAGAGAAAACCAA
                      ____________________________________________________________
consensus GTGAAGAAATCCCATGGCTGCTGTCGGCCGGTGGTTGAGAAGACTAGAAGAGAAAACCAA
 
. : . : . : . : . : . :
JMSF025H12+ GTTTGTTCACGGAAGCTTCAAACAAAACCGCCGACTTTGACCCTTT
JMSF042F16+ GTTTGTTCACGGAAGCTTCAAACAAAACCGCCGACTTTGACCCTTTGAACCAGCTACGTC
                      ____________________________________________________________
consensus GTTTGTTCACGGAAGCTTCAAACAAAACCGCCGACTTTGACCCTTTGAACCAGCTACGTC