Previous Contig 007486:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025D13Sequence645007486 (3)gb:AP001298_18209772e-17Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:F20C19.783013404 (13)gb:AY748245_16266092e-61Nicotiana tabacum cytosolic acetoacetyl-coenzyme A thiolase (AACT1) mRNA, comple
JMSF028L15Sequence645007486 (3)gb:AP001298_18209772e-17Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:F20C19.714013404 (13)gb:AY748245_16266091e-61Nicotiana tabacum cytosolic acetoacetyl-coenzyme A thiolase (AACT1) mRNA, comple
JMSF042F01Sequence289007486 (3)gb:AP001298_18209770.002Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:F20C19.998013404 (13)gb:AY748245_16266092e-61Nicotiana tabacum cytosolic acetoacetyl-coenzyme A thiolase (AACT1) mRNA, comple

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF028L15+ GAGTCCAAATCAGTCTTCCTTGGATCTATGCTCTTCACCTTGAGCA
JMSF025D13+ GAGTCCAAATCAGTCTTCCTTGGATCTATGCTCTTCACCTTGAGCA
                      ____________________________________________________________
consensus GAGTCCAAATCAGTCTTCCTTGGATCTATGCTCTTCACCTTGAGCA
 
. : . : . : . : . : . :
JMSF028L15+ ATACATCACTTAGCGATTTCTCCTTTCGTTTTGGCTTTGCCCTCACGGATCCTTCAGAGT
JMSF025D13+ ATACATCACTTAGCGATTTCTCCTTTCGTTTTGGCTTTGCCCTCACGGATCCTTCAGAGT
                      ____________________________________________________________
consensus ATACATCACTTAGCGATTTCTCCTTTCGTTTTGGCTTTGCCCTCACGGATCCTTCAGAGT
 
. : . : . : . : . : . :
JMSF028L15+ CTCCAGGCATACTAGATTGCGCATTTGTTGGTCTACTAGTAGTTAATTTCACCTCGATCT
JMSF025D13+ CTCCAGGCATACTAGATTGCGCATTTGTTGGTCTACTAGTAGTTAATTTCACCTCGATCT
                      ____________________________________________________________
consensus CTCCAGGCATACTAGATTGCGCATTTGTTGGTCTACTAGTAGTTAATTTCACCTCGATCT
 
. : . : . : . : . : . :
JMSF028L15+ CCATATCCATCTTTTTCAAGTACCTTTCTCTGCCAGCAGCACCTCCTCTGGGTTAGGCTT
JMSF025D13+ CCATATCCATCTTTTTCAAGTACCTTTCTCTGCCAGCAGCACCTCCTCTGGGTTAGGCTT
                      ____________________________________________________________
consensus CCATATCCATCTTTTTCAAGTACCTTTCTCTGCCAGCAGCACCTCCTCTGGGTTAGGCTT
 
. : . : . : . : . : . :
JMSF028L15+ GTGCACCTCATTCACATTGTCACCTCCCTGTTCATTTTCAGGTGATTCCAAAACCAATCT
JMSF025D13+ GTGCACCTCATTCACATTGTCACCTCCCTGTTCATTTTCAGGTGATTCCAAAACCAATCT
                      ____________________________________________________________
consensus GTGCACCTCATTCACATTGTCACCTCCCTGTTCATTTTCAGGTGATTCCAAAACCAATCT
 
. : . : . : . : . : . :
JMSF028L15+ CTCAACTCCATCCCGCAACCAGCGCATAGGTTCAGGCCTCGAGTCTCTGATTCCCGAACC
JMSF025D13+ CTCAACTCCATCCCGCAACCAGCGCATAGGTTCAGGCCTCGAGTCTCTGATTCCCGAACC
                      ____________________________________________________________
consensus CTCAACTCCATCCCGCAACCAGCGCATAGGTTCAGGCCTCGAGTCTCTGATTCCCGAACC
 
. : . : . : . : . : . :
JMSF028L15+ AAAAGTCGAAGATCTGGCAGGCGGTGGAGCAACGGGTTTCTTCGAGGCGCCCCAGTTGTC
JMSF025D13+ AAAAGTCGAAGATCTGGCAGGCGGTGGAGCAACGGGTTTCTTCGAGGCGCCCCAGTTGTC
JMSF042F01+ TGGCAGGCGGTGGAGCAACGGGTTTNTTNGAGGCGCCCCAGTTGTC
                      ____________________________________________________________
consensus AAAAGTCGAAGATCTGGCAGGCGGTGGAGCAACGGGTTTCTTCGAGGCGCCCCAGTTGTC
 
. : . : . : . : . : . :
JMSF028L15+ AGCCGTAGATGCTTCACCACCGGCTCCGAAAGTACCATGCTTTGAACGAGCAGAAGCAGG
JMSF025D13+ AGCCGTAGATGCTTCACCACCGGCTCCGAAAGTACCATGCTTTGAACGAGCAGAAGCAGG
JMSF042F01+ AGCCGTAGATGCTTCACCNCCGGCTCCGAAAGTACCATGCTTTGAACGAGCAGAAGCAGG
                      ____________________________________________________________
consensus AGCCGTAGATGCTTCACCACCGGCTCCGAAAGTACCATGCTTTGAACGAGCAGAAGCAGG
 
. : . : . : . : . : . :
JMSF028L15+ AGTAAAATTGTACGATAATAAGGGTTTCTTTGCTGATTCCAAGTTATCAATCTCGTCAGC
JMSF025D13+ AGTAAAATTGTACGATAATAAGGGTTTCTTTGCTGATTCCAAGTTATCAATCTCGTCAGC
JMSF042F01+ AGTAAAATTGTACGATAATAAGGGTTTCTTTGCTGATTCCAAGTTATCAATCTCGTCAGC
                      ____________________________________________________________
consensus AGTAAAATTGTACGATAATAAGGGTTTCTTTGCTGATTCCAAGTTATCAATCTCGTCAGC
 
. : . : . : . : . : . :
JMSF028L15+ TCTCGAGGATTGATCGAAATCCGCAGCCCTAGATGGTGGGCCCTCAGCAAACCGCTTTTT
JMSF025D13+ TCTCGAGGATTGATCGAAATCCGCAGCCCTAGATGGTGGGCCCTCAGCAAACCGCTTTTT
JMSF042F01+ TCTCGAGGATTGATCGAAATCCGCAGCCCTAGATGGTGGGCCCTCAGCAAACCGCTTTTT
                      ____________________________________________________________
consensus TCTCGAGGATTGATCGAAATCCGCAGCCCTAGATGGTGGGCCCTCAGCAAACCGCTTTTT
 
. : . : . : . : . : . :
JMSF028L15+ GGGACACCTCGTAGGGAGCCGGAGCGTCGAGCCGTAGCCATGACAAGAGCCATA
JMSF025D13+ GGGACACCTCGTAGGGAGCCGGAGCGTCGAGCCGTAGCCATGACAAGAGCCATA
JMSF042F01+ GGGACACCTCGTAGGGAGCCGGAGCGTCGAGCCGTAGCCATGACAAGAGCCATATCGTGC
                      ____________________________________________________________
consensus GGGACACCTCGTAGGGAGCCGGAGCGTCGAGCCGTAGCCATGACAAGAGCCATATCGTGC