Previous Contig 007480:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012K05Sequence603007480 (5)gb:AY062632_15652889e-20Arabidopsis thaliana Unknown protein (At1g16720; F17F16.7) mRNA, complete cds.>g743010901 (4)gb:AY062632_15652882e-79Arabidopsis thaliana Unknown protein (At1g16720; F17F16.7) mRNA, complete cds.>g
JMFF049F22Sequence610007480 (5)gb:AY062632_15652888e-21Arabidopsis thaliana Unknown protein (At1g16720; F17F16.7) mRNA, complete cds.>g542010901 (4)gb:AP003761_18330767e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P001
JMFS132D07Sequence632007480 (5)gb:AY062632_15652881e-26Arabidopsis thaliana Unknown protein (At1g16720; F17F16.7) mRNA, complete cds.>g
JMSF029B08Sequence647007480 (5)gb:AY062632_15652882e-18Arabidopsis thaliana Unknown protein (At1g16720; F17F16.7) mRNA, complete cds.>g699010901 (4)gb:AY062632_15652887e-79Arabidopsis thaliana Unknown protein (At1g16720; F17F16.7) mRNA, complete cds.>g
JMSF042C21Sequence771007480 (5)gb:AY062632_15652883e-37Arabidopsis thaliana Unknown protein (At1g16720; F17F16.7) mRNA, complete cds.>g746010901 (4)gb:AY062632_15652881e-83Arabidopsis thaliana Unknown protein (At1g16720; F17F16.7) mRNA, complete cds.>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042C21+ TGATCGGCACTCCTTACCAGAGCCTTGACTGTGTAACCCCTAAGCATGAGC
                      ____________________________________________________________
consensus TGATCGGCACTCCTTACCAGAGCCTTGACTGTGTAACCCCTAAGCATGAGC
 
. : . : . : . : . : . :
JMFS132D07+ GCCGACGCGGCTGGTAGCCCCGACGACGAGGACGGTGGTGTTC
JMFF049F22+ TGGTGTTC
JMSF042C21+ TTCCGGACAACGATGCGGCCGACGCGGCTGGTAGCCCCGACGACGAGGACGGTGGTGTTN
                      ____________________________________________________________
consensus TTCCGGACAACGATGCGGCCGACGCGGCTGGTAGCCCCGACGACGAGGACGGTGGTGTTC
 
. : . : . : . : . : . :
JMSF029B08+ CCAGGGATGGCGAATTCGCACATTGGGCCCCCCTCGCGGATAAGAAGGCTCGCC
JMFS132D07+ TGCGCCCCAGGGATGGCGAATTCGCACATTGGGCCCCCCTCGCGGATAAGAAGGCTCGCC
JMFF012K05+ TGCGCCCCAGGGATGGCGAATTCGCACATTGGGCCCCCCTCGCGGATAAGAAGGCTCGCC
JMFF049F22+ TGCGCCCCAGGGATGGCGAATTCGCACATGGGGCCCCCCTCGCGGATAAGAAGGCTCGCC
JMSF042C21+ TGCGCCCCAGGGATGGCGAATTCGCACATTGGGCCCCCCTCGCGGATAAGAAGGCTCGCC
                      ____________________________________________________________
consensus TGCGCCCCAGGGATGGCGAATTCGCACATTGGGCCCCCCTCGCGGATAAGAAGGCTCGCC
 
. : . : . : . : . : . :
JMSF029B08+ TCATCGTCGGTGCGGTTGGTCCTGGAAATCTGCCCTAATCCGGAGAATTTCCGCCACACT
JMFS132D07+ TCATCGTCGGTGCGGTTGGTCCTGGAAATCTGCCCTAATCCGGAGAATTTCCGCCACACT
JMFF012K05+ TCATCGTCGGTGCGGTTGGTCCTGGAAATCTGCCCTAATCCGGAGAATTTCCGCCACACT
JMFF049F22+ TCATCGTCGGTGCGGTGGGTCCTGGAAATCTGCCCTAATCCGGAGAATTTCCGCCACACT
JMSF042C21+ TCATCGTCGGTGCGGTTGGTCCTGGAAATCTGCCCTAATCCGGAGAATTTCCGCCACACT
                      ____________________________________________________________
consensus TCATCGTCGGTGCGGTTGGTCCTGGAAATCTGCCCTAATCCGGAGAATTTCCGCCACACT
 
. : . : . : . : . : . :
JMSF029B08+ TCGTCGAAAATTTGACGCGAACGTCGCCCCAACCCCACTGGATTCACTTCATCGAGTCTC
JMFS132D07+ TCGTCGAAAATTTGACGCGAACGTCGCCCCAACCCCACTGGATTCACTTAATCGAGTCTC
JMFF012K05+ TCGTCGAAAATTTGACGCGAACGTCGCCCCAACCCCACTGGATTCACTTCATCGAGTCTC
JMFF049F22+ TCGTCGAAAATTTGACGCGAACGTCGCCCCAACCCCACTGGATTCACTTCATCGAGTCTC
JMSF042C21+ TCGTCGAAAATTTGACGCGAACGTCGCCCCAACCCCACTGGATTCACTTCATCGAGTCTC
                      ____________________________________________________________
consensus TCGTCGAAAATTTGACGCGAACGTCGCCCCAACCCCACTGGATTCACTTCATCGAGTCTC
 
. : . : . : . : . : . :
JMSF029B08+ TTTATGACGGACACTGAAGACGACGATTGATCCTCGCCGTTGAACGAGCTAGTAATTTCT
JMFS132D07+ TTTATGACGGACACTGAAGACGACGATTGATCCTCGCCGTTGAACGAGCTAGTAATTTCT
JMFF012K05+ TTTATGACGGACACTGAAGACGACGATTGATCCTCGCCGTTGAACGAGCTAGTAATTTCT
JMFF049F22+ TTTATGACGGACACTGAAGACGACGATTGATCCTCGCCGTTGAACGAGCTAGTAATTTCT
JMSF042C21+ TTTATGACGGACACTGAAGACGACGATTGATCCTCGCCGTTGAACGAGCTAGTAATTTCT
                      ____________________________________________________________
consensus TTTATGACGGACACTGAAGACGACGATTGATCCTCGCCGTTGAACGAGCTAGTAATTTCT
 
. : . : . : . : . : . :
JMSF029B08+ CCGGCGTCATTCTCCTTGTTCTCCTCCTCCTCGCCGTCGTCATTCTGAAGCTCCGTCTTC
JMFS132D07+ CCGGCGTCATTCTCCTTGTTCTCCTCCTCCTCGCCGTCGTCATTCTGAAGCTCCGTCTTC
JMFF012K05+ CCGGCGTCATTCTCCTTGTTCTCCTCCTCCTCGCCGTCGTCATTCTGAAGCTCCGTCTTC
JMFF049F22+ CCGGCGTCATTCTCCTTGTTCTCCTCCTCCTCGCCGTCGTCATTCTGAAGCTCCGTCTTC
JMSF042C21+ CCGGCGTCATTCTCCTTGTTCTCCTCCTCCTCGCCGTCGTCATTCTGAAGCTCCGTCTTC
                      ____________________________________________________________
consensus CCGGCGTCATTCTCCTTGTTCTCCTCCTCCTCGCCGTCGTCATTCTGAAGCTCCGTCTTC
 
. : . : . : . : . : . :
JMSF029B08+ TTCTTCCTCCTCCTCCTCTTCTTCTTGTCCTTGCCAACGGCGTCGGGAGTAGAAGAAGAA
JMFS132D07+ TTCTTCCTCCTCCTCCTCTTCTTCTTGTCCTTGCCAACGGCGTCGGGAGTAGAAGAAGAA
JMFF012K05+ TTCTTCCTCCTCCTCCTCTTCTTCTTGTCCTTGCCAACGGCGTCGGGAGTAGAAGAAGAA
JMFF049F22+ TTCTTCCTCCTCCTCCTCTTCTTCTTGTCCTTGCCAACGGCGTCGGGAGTAGAAGAAGAA
JMSF042C21+ TTCTTCCTCCTCCTCCTCTTCTTCTTGTCCTTGCCAACGGCGTCGGGAGTAGAAGAAGAA
                      ____________________________________________________________
consensus TTCTTCCTCCTCCTCCTCTTCTTCTTGTCCTTGCCAACGGCGTCGGGAGTAGAAGAAGAA
 
. : . : . : . : . : . :
JMSF029B08+ ACAGTCGCCCTCGAAACAACAAACCCGCTCCAACCCCCACTCCCACCCGCCGTCGCGATA
JMFS132D07+ ACAGTCGCCCTCGAAACAACAAACCCGCTCCAACCCCCACTCCCACCCGCCGTCGCGATA
JMFF012K05+ ACAGTCGCCCTCGAAACAACAAACCCGCTCCAACCCCCACTCCCACCCGCCGTCGCGATA
JMFF049F22+ ACAGTCGCCCTCGAAACAACAAACCCGCTCCAACCCCCACTCCCACCCGCCGTCGCGATA
JMSF042C21+ ACAGTCGCCCTCGAAACAACAAACCCGCTCCAACCCCCACTCCCACCCGCCGTCGCGATA
                      ____________________________________________________________
consensus ACAGTCGCCCTCGAAACAACAAACCCGCTCCAACCCCCACTCCCACCCGCCGTCGCGATA
 
. : . : . : . : . : . :
JMSF029B08+ CGGATTGTTCCGGCCGACACGGAATCAAACGGAGACGGCTTCGATCTCCATATTCGCTGA
JMFS132D07+ CGGATTGTTCCGGCCGACACGGAATCAAACGGAGACGGCTTCGATCTCCATATTCGCTGA
JMFF012K05+ CGGATTGTTCCGGCCGACACGGAATCAAACGGAGACGGCTTCGATCTCCATATTCGCTGA
JMFF049F22+ CGGATTGTTCCGGCCGACACGGAATCAAACGGAGACGGCTTCGATCTCCATATTCGCTGA
JMSF042C21+ CGGATTGTTCCGGCCGACACGGAATCAAACGGAGACGGCTTCGATCTCCATATTCGCTGA
                      ____________________________________________________________
consensus CGGATTGTTCCGGCCGACACGGAATCAAACGGAGACGGCTTCGATCTCCATATTCGCTGA
 
. : . : . : . : . : . :
JMSF029B08+ TTACCGTTGAACCCGACGGCCGTAGCAGCTGTGAAAGCACTGCTCATCTCTTCAAAAAAA
JMFS132D07+ TTACCGTTGAACCCGACGGCCGTAGCAGCTGTGAAAGCACTGCTCATCTCTTCAAAAAAA
JMFF012K05+ TTACCGTTGAACCCGACGGCCGTAGCAGCTGTGAAAGCACTGCTCATCTCTTCAAAAAAA
JMFF049F22+ TTACCGTTGAACCCGACGGCCGTAGCAGCTGTGAAAGCACTGCTCATCTCTTCAAAAAAA
JMSF042C21+ TTACCGTTGAACCCGACGGCCGTAGCAGCTGTGAAAGCACTGCTCATCTCTTCAAAAAAA
                      ____________________________________________________________
consensus TTACCGTTGAACCCGACGGCCGTAGCAGCTGTGAAAGCACTGCTCATCTCTTCAAAAAAA
 
. : . : . : . : . : . :
JMSF029B08+ TCAAACACCCTGAGAAATCTCTCCCGCTTCAATCAAATCTCCGCCGAGCCCCCGCTCTCT
JMFS132D07+ TCAAACACCCTGAGAAATCTCTCCCGCTTCAATCAAATCTCCGCCGAGC
JMFF012K05+ TCAAACACCCTGAGAAATCTCTCCCGCTTCAATCAAATCTCCGCCGAGCCCCCGCTCTCT
JMFF049F22+ TCAAACACCCTGAGAAATCTCTCCCGCTTCAATCAAATCTCCGCCGAGCCCCCGCTCTCT
JMSF042C21+ TCAAACACCCTGAGAAATCTCTCCCGCTTCAATCAAATCTCCGCCGAGCCCCCGCTCTCT
                      ____________________________________________________________
consensus TCAAACACCCTGAGAAATCTCTCCCGCTTCAATCAAATCTCCGCCGAGCCCCCGCTCTCT
 
. : . : . : . : . : . :
JMSF029B08+ CTCGGGTTTCTCCAAAATGGCGTCGATCGGAGAGTAATGCTGGTGGCTAGTC
JMFF012K05+ CT
JMFF049F22+ CT
JMSF042C21+ CTCGGGTTTCTCCAAAATGGCGTCGATCGGAGAGTAATGCTGGTGGCTAGTCAGGCACCC
                      ____________________________________________________________
consensus CTCGGGTTTCTCCAAAATGGCGTCGATCGGAGAGTAATGCTGGTGGCTAGTCAGGCACCC