Previous Contig 007476:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF033C03Sequence641007476 (3)gb:BT008621_16398328e-17Arabidopsis thaliana clone RAFL21-18-G06 (R51064) unknown protein (At1g75420) mR692013395 (5)gb:BT008621_16398323e-74Arabidopsis thaliana clone RAFL21-18-G06 (R51064) unknown protein (At1g75420) mR
JMSF042C14Sequence778007476 (3)gb:AP001366_18212135e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046801013395 (5)gb:BT008621_16398326e-77Arabidopsis thaliana clone RAFL21-18-G06 (R51064) unknown protein (At1g75420) mR
JMSF048J14Sequence685007476 (3)gb:AP001366_18212135e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046774013395 (5)gb:BT008621_16398321e-88Arabidopsis thaliana clone RAFL21-18-G06 (R51064) unknown protein (At1g75420) mR

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042C14+ AACAGCATCCAGCCATTTTCCAGCAACAGCAGTGTTTAAAACAACCAAGTCAGCTTTT
                      ____________________________________________________________
consensus AACAGCATCCAGCCATTTTCCAGCAACAGCAGTGTTTAAAACAACCAAGTCAGCTTTT
 
. : . : . : . : . : . :
JMSF048J14+ TTCTTGACCCCTCGCAGGGAAAACCTGAACTCCTCGGTCCAGC
JMSF033C03+ TCGGTCCAGC
JMSF042C14+ AGAGCAGTATCTTTTGCTTCTTGACCCCTCGCAGGGAAAACCTGAACTCCTCGGTCCAGC
                      ____________________________________________________________
consensus AGAGCAGTATCTTTTGCTTCTTGACCCCTCGCAGGGAAAACCTGAACTCCTCGGTCCAGC
 
. : . : . : . : . : . :
JMSF048J14+ ATTTTGTGTTCCAAACTGTATACAATATTATCTGTTTCAGCTGGCCTTTGATTTGTGATC
JMSF033C03+ ATTTTGTGTTCCAAACTGTATACAATATTATCTGTTTCAGCTGGCCTTTGATTTGTGATC
JMSF042C14+ ATTTTGTGTTCCAAACTGTATACAATATTATCTGTTTCAGCTGGCCTTTGATTTGTGATC
                      ____________________________________________________________
consensus ATTTTGTGTTCCAAACTGTATACAATATTATCTGTTTCAGCTGGCCTTTGATTTGTGATC
 
. : . : . : . : . : . :
JMSF048J14+ CAACAGACTTCAGCACCAACACCCCTCAACAGAAAAGCCAGTTCCATCAACAAGAGAGGT
JMSF033C03+ CAACAGACTTCAGCACCAACACCCCTCAACAGAAAAGCCAGTTCCATCAACAAGAGAGGT
JMSF042C14+ CAACAGACTTCAGCACCAACACCCCTCAACAGAAAAGCCAGTTCCATCAACAAGAGAGGT
                      ____________________________________________________________
consensus CAACAGACTTCAGCACCAACACCCCTCAACAGAAAAGCCAGTTCCATCAACAAGAGAGGT
 
. : . : . : . : . : . :
JMSF048J14+ CCGCCAGAAAGAGAGAGCTCATGTGAAACCAGAAGCACGAGCTTCGACTTCATGAAACTG
JMSF033C03+ CCGCCAGAAAGAGAGAGCTCATGTGAAACCAGAAGCACGAGCTTCGACTTCATGAAACTG
JMSF042C14+ CCGCCAGAAAGAGAGAGCTCATGTGAAACCAGAAGCACGAGCTTCGACTTCATGAAACTG
                      ____________________________________________________________
consensus CCGCCAGAAAGAGAGAGCTCATGTGAAACCAGAAGCACGAGCTTCGACTTCATGAAACTG
 
. : . : . : . : . : . :
JMSF048J14+ AGCGGGCTCTGACGTACACCAGCAGGCGCAATCTGCTTAGACACTTCCACATTAGCACCA
JMSF033C03+ AGCGGGCTCTGACGTACACCAGCAGGCGCAATCTGCTTAGACACTTCCACATTAGCACCA
JMSF042C14+ AGCGGGCTCTGACGTACACCAGCAGGCGCAATCTGCTTAGACACTTCCACATTAGCACCA
                      ____________________________________________________________
consensus AGCGGGCTCTGACGTACACCAGCAGGCGCAATCTGCTTAGACACTTCCACATTAGCACCA
 
. : . : . : . : . : . :
JMSF048J14+ AATAGCTTCCCGGACCCCACCTCACTGCGGCAATCGCAGGCGGAGTCGATGCCGCCCCTT
JMSF033C03+ AATAGCTTCCCGGACCCCACCTCACTGCGGCAATCGCAGGCGGAGTCGATGCCGCCCCTT
JMSF042C14+ AATAGCTTCCCGGACCCCACCTCACTGCGGCAATCGCAGGCGGAGTCGATGCCGCCCCTT
                      ____________________________________________________________
consensus AATAGCTTCCCGGACCCCACCTCACTGCGGCAATCGCAGGCGGAGTCGATGCCGCCCCTT
 
. : . : . : . : . : . :
JMSF048J14+ ATCAGAAAGGCAATGACTGTGGTGACGGAGAGCATGACAAGGAGAGCCACCACCATAAGC
JMSF033C03+ ATCAGAAAGGCAATGACTGTGGTGACGGAGAGCATGACAAGGAGAGCCACCACCATAAGC
JMSF042C14+ ATCAGAAAGGCAATGACTGTGGTGACGGAGAGCATGACAAGGAGAGCCACCACCATAAGC
                      ____________________________________________________________
consensus ATCAGAAAGGCAATGACTGTGGTGACGGAGAGCATGACAAGGAGAGCCACCACCATAAGC
 
. : . : . : . : . : . :
JMSF048J14+ CAGCGCCGCTTCCGGAACAACGCCGACGTCGCGGAAGAATAAGGAGACTGAAGCTTCGCC
JMSF033C03+ CAGCGCCGCTTCCGGAACAACGCCGACGTCGCGGAAGAATAAGGAGACTGAAGCTTCGCC
JMSF042C14+ CAGCGCCGCTTCCGGAACAACGCCGACGTCGCGGAAGAATAAGGAGACTGAAGCTTCGCC
                      ____________________________________________________________
consensus CAGCGCCGCTTCCGGAACAACGCCGACGTCGCGGAAGAATAAGGAGACTGAAGCTTCGCC
 
. : . : . : . : . : . :
JMSF048J14+ ATCCCAGTGGTGCTAGGGTTTGTTTGGTGGATCCCAGTCACGATAGACGGCATCTTAGGG
JMSF033C03+ ATCCCAGTGGTGCTAGGGTTTGTTTGGTGGATCCCAGTCACGATAGACGGCATCTTAGGG
JMSF042C14+ ATCCCAGTGGTGCTAGGGTTTGTTTGGTGGATCCCAGTCACGATAGACGGCATCTTAGGG
                      ____________________________________________________________
consensus ATCCCAGTGGTGCTAGGGTTTGTTTGGTGGATCCCAGTCACGATAGACGGCATCTTAGGG
 
. : . : . : . : . : . :
JMSF048J14+ AAGCTGAATTTGGCGAGGAGGGATACTGTGCGTACATTTGTCTTTCACAGTCGACACTTG
JMSF033C03+ AAGCTGAATTTGGCGAGGAGGGATACTGTGCGTACATTTGTCTTTCACAGTCGACACTTG
JMSF042C14+ AAGCTGAATTTGGCGAGGAGGGATACTGTGCGTACATTTGTCTTTCACAGTCGACACTTG
                      ____________________________________________________________
consensus AAGCTGAATTTGGCGAGGAGGGATACTGTGCGTACATTTGTCTTTCACAGTCGACACTTG
 
. : . : . : . : . : . :
JMSF048J14+ GAAGCTGCGGGGTCAAGGGGGTGTTTGCGGTGGCACTGTGAATCATTCACTTTCCGGCGG
JMSF033C03+ GAAGCTGCGGGGTCAAGGGGGTGTTTGCGGTGGCACTGTGAATCATTCACTTTCCGGCGG
JMSF042C14+ GAAGCTGCGGGGTCAAGGGGGTGTTTGCGGTGGCACTGTGAATCATTCACTTTCCGGCGG
                      ____________________________________________________________
consensus GAAGCTGCGGGGTCAAGGGGGTGTTTGCGGTGGCACTGTGAATCATTCACTTTCCGGCGG
 
. : . : . : . : . : . :
JMSF048J14+ GTCGCCGCTTCACCGTCGATATGGTAAACTTTGATTAGA
JMSF033C03+ GTCGCCGCTTCACCGTCGATATGGTAAACT
JMSF042C14+ GTCGCCGCTTCACCGTCGATATGGTAAACTTTGATTAGATTATTCCTTTGCGCAATTCCA
                      ____________________________________________________________
consensus GTCGCCGCTTCACCGTCGATATGGTAAACTTTGATTAGATTATTCCTTTGCGCAATTCCA