Previous Contig 007472:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040J19Sequence484007472 (2)pir|T01226|T012261e-09probable methylenetetrahydrofolate dehydrogenase (NADP) (EC 1.5.1.5) F6N23.26 - 673013392 (2)pir|T01226|T012269e-69probable methylenetetrahydrofolate dehydrogenase (NADP) (EC 1.5.1.5) F6N23.26 -
JMSF042B14Sequence526007472 (2)pir|T01226|T012269e-17probable methylenetetrahydrofolate dehydrogenase (NADP) (EC 1.5.1.5) F6N23.26 - 625013392 (2)pir|T01226|T012265e-58probable methylenetetrahydrofolate dehydrogenase (NADP) (EC 1.5.1.5) F6N23.26 -

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF040J19+ TGTTG
JMSF042B14+ TTCGTATGACTTGATCCCCACAGCTTCACACGCCTTTTTCTTGTTG
                      ____________________________________________________________
consensus TTCGTATGACTTGATCCCCACAGCTTCACACGCCTTTTTCTTGTTG
 
. : . : . : . : . : . :
JMFF040J19+ CGCACATAAGTTGCAGAATCCTTCCTTTCCCCAACCAGGATAACTGCCAGACCAGGGACA
JMSF042B14+ CGCACATAAGTTGCAGAATCCTTCCTTTCCCCAACCAGGATAACTGCCAGACCAGGGACA
                      ____________________________________________________________
consensus CGCACATAAGTTGCAGAATCCTTCCTTTCCCCAACCAGGATAACTGCCAGACCAGGGACA
 
. : . : . : . : . : . :
JMFF040J19+ ACACCTATAGCATCCTTCATCTTCGCTATTTCAGCACATATTTCTTCTTTGATTTCTTTT
JMSF042B14+ ACACCTATAGCATCCTTCATCTTCGCTATTTCAGCACATATTTCTTCTTTGATTTCTTTT
                      ____________________________________________________________
consensus ACACCTATAGCATCCTTCATCTTCGCTATTTCAGCACATATTTCTTCTTTGATTTCTTTT
 
. : . : . : . : . : . :
JMFF040J19+ GAGACCTTTTTCCCATCAATAACATTGGAAGAGGGCTCAGCCGTCACTGAAGCGGTGACG
JMSF042B14+ GAGACCTTTTTCCCATCAATAACATTGGAAGAGGGCTCAGCCGTCACTGAAGCGGTGACG
                      ____________________________________________________________
consensus GAGACCTTTTTCCCATCAATAACATTGGAAGAGGGCTCAGCCGTCACTGAAGCGGTGACG
 
. : . : . : . : . : . :
JMFF040J19+ GCGGATGAGCAGCAAAAAGCGGTGGCGGAGTTCGAAGAAGAAATGGAATCTCTGTGAGTG
JMSF042B14+ GCGGATGAGCAGCAAAAAGCGGTGGCGGAGTTCGAAGAAGAAATGGAATCTCTGTGAGTG
                      ____________________________________________________________
consensus GCGGATGAGCAGCAAAAAGCGGTGGCGGAGTTCGAAGAAGAAATGGAATCTCTGTGAGTG
 
. : . : . : . : . : . :
JMFF040J19+ GTGATCGTCCTGCGGAAAGTGGAGCCAAGCTGGAAATGAAGGTGGCCGGGCTTGCTGAAC
JMSF042B14+ GTGATCGTCCTGCGGAAAGTGGAGCCAAGCTGGAAATGAAGGTGGCCGGGCTTGCTGAAC
                      ____________________________________________________________
consensus GTGATCGTCCTGCGGAAAGTGGAGCCAAGCTGGAAATGAAGGTGGCCGGGCTTGCTGAAC
 
. : . : . : . : . : . :
JMFF040J19+ GGAAGGACTCTAGCTGACACGGCAGCGGTCGACGACGGAGAGGAGTCAGTGAACCTCATC
JMSF042B14+ GGAAGGACTCTAGCTGACACGGCAGCGGTCGACGACGGAGAGGAGTCAGTGAACCTCATC
                      ____________________________________________________________
consensus GGAAGGACTCTAGCTGACACGGCAGCGGTCGACGACGGAGAGGAGTCAGTGAACCTCATC
 
. : . : . : . : . : . :
JMFF040J19+ TTCATAAGAGCCATGGAGGACGTCGTCGTTGCGGCCATTGTCCTGTGACCAACGAGAAGA
JMSF042B14+ TTCATAAGAGCCATGGAGGACGTCGTCGTTGCGGCCATTGTCCTGTGACCAACGAGAAGA
                      ____________________________________________________________
consensus TTCATAAGAGCCATGGAGGACGTCGTCGTTGCGGCCATTGTCCTGTGACCAACGAGAAGA
 
. : . : . : . : . : . :
JMFF040J19+ CGAGAAAGATGCTTGAGTGTCAGACCTATGCTTGCAAGCTTTTGTTAAATGGT
JMSF042B14+ CGAGAAAGATGCTTGAGTGTCAGACCTATGCTTGCAAGCTTTTGTTAAATGGTGTCACCC
                      ____________________________________________________________
consensus CGAGAAAGATGCTTGAGTGTCAGACCTATGCTTGCAAGCTTTTGTTAAATGGTGTCACCC