Previous Contig 007463:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS109F03Sequence627007463 (3)gb:AP004256_18392151e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ12
JMSF012L11Sequence491007463 (3)gb:AP004256_18392157e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ12740013389 (2)gb:AY065419_15665262e-61Arabidopsis thaliana unknown protein (At1g64430) mRNA, complete cds.>gb:AY142664
JMSF042A14Sequence459007463 (3)gb:AP004256_18392150.042Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ12654013389 (2)gb:AP004256_18392144e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ12

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF012L11+ TCAAAGGACAGACCT
JMFS109F03+ ATATTGTGTAGGTATTCACATCCGGCCTTGACCACTTCCATTTCTCAAAGGACAGACCT
                      ____________________________________________________________
consensus ATATTGTGTAGGTATTCACATCCGGCCTTGACCACTTCCATTTCTCAAAGGACAGACCT
 
. : . : . : . : . : . :
JMSF012L11+ TTCTGATTAACATCAGGATCAAAGGAGGAGCGCATAGCTTGGAAAACAGAGAGAGCCAAG
JMFS109F03+ TTCTGATTAACATCAGGATCAAAGGAGGAGCGCATAGCTTGGAAAACAGAGAGAGCCAAG
                      ____________________________________________________________
consensus TTCTGATTAACATCAGGATCAAAGGAGGAGCGCATAGCTTGGAAAACAGAGAGAGCCAAG
 
. : . : . : . : . : . :
JMSF012L11+ TCAGCATTGCTACGATCAAGCGCGGCAGATATGATCAAGGAGCAATCGGAAGAGCTTACG
JMFS109F03+ TCAGCATTGCTACGATCAAGCGCGGCAGATATGATCAAGGAGCAATCGGAAGAGCTTACG
                      ____________________________________________________________
consensus TCAGCATTGCTACGATCAAGCGCGGCAGATATGATCAAGGAGCAATCGGAAGAGCTTACG
 
. : . : . : . : . : . :
JMSF012L11+ GTGCCGCCGCTCCTCAGAGTCGACTCCGCAATGATGTTGAGAACTTCGTTGGCATCCGCG
JMFS109F03+ GTGCCGCCGCTCCTCAGAGTCGACTCCGCAATGATGTTGAGAACTTCGTTGGCATCCGCG
JMSF042A14+ GACTCCGCAATGATGTTGAGAACTTCGTTGGCATCCGCG
                      ____________________________________________________________
consensus GTGCCGCCGCTCCTCAGAGTCGACTCCGCAATGATGTTGAGAACTTCGTTGGCATCCGCG
 
. : . : . : . : . : . :
JMSF012L11+ GCGGTGGAGACTCGGCGTAGCAATTCGTCGTCCAACAGCCGCGACGCCTCACTGTCATTA
JMFS109F03+ GCGGTGGAGACTCGGCGTAGCAATTCGTCGTCCAACAGCCGCGACGCCTCACTGTCATTA
JMSF042A14+ GCGGTGGAGACTCGGCGTAGCAATTCGTCGTCCAACAGCCGCGACGCCTCACTGTCATTA
                      ____________________________________________________________
consensus GCGGTGGAGACTCGGCGTAGCAATTCGTCGTCCAACAGCCGCGACGCCTCACTGTCATTA
 
. : . : . : . : . : . :
JMSF012L11+ GCCGCCTCACTCAAAGCAGCTCTGGTCTTAAAGCTGCAAAAACTGTTGCGAGAACAGCAG
JMFS109F03+ GCCGCCTCACTCAAAGCAGCTCTGGTCTTAAAGCTGCAAAAACTGTTGCGAGAACAGCAG
JMSF042A14+ GCCGCCTCACTCAAAGCAGCTCTGGTCTTAAAGCTGCAAAAACTGTTGCGAGAACAGCAG
                      ____________________________________________________________
consensus GCCGCCTCACTCAAAGCAGCTCTGGTCTTAAAGCTGCAAAAACTGTTGCGAGAACAGCAG
 
. : . : . : . : . : . :
JMSF012L11+ GATAACGCACGGTTACCGGGAAGGCGGCGGCGGAAGAAGAGATAGAAGAGAGCACCGGTG
JMFS109F03+ GATAACGCACGGTTACCGGGAAGGCGGCGGCGGAAGAAGAGATAGAAGAGAGCACCGGTG
JMSF042A14+ GATAACGCACGGTTACCGGGAAGGCGGCGGCGGAAGAAGAGATAGAAGAGAGCACCGGTG
                      ____________________________________________________________
consensus GATAACGCACGGTTACCGGGAAGGCGGCGGCGGAAGAAGAGATAGAAGAGAGCACCGGTG
 
. : . : . : . : . : . :
JMSF012L11+ CCTGTGACGGAGAATCTCTGAGGGAAACAGGAGAGACAAGCAGGGGAGCTCAACTTGATA
JMFS109F03+ CCTGTGACGGAGAATCTCTGAGGGAAACAGGAGAGACAAGCAGGGGAGCTCAACTTGATA
JMSF042A14+ CCTGTGACGGAGAATCTCTGAGGGAAACAGGAGAGACAAGCAGGGGAGCTCAACTTGATA
                      ____________________________________________________________
consensus CCTGTGACGGAGAATCTCTGAGGGAAACAGGAGAGACAAGCAGGGGAGCTCAACTTGATA
 
. : . : . : . : . : . :
JMSF012L11+ CTCATATGTAATGTAACGTCTTGAATATTAGCATACAATACAGTAATCAACCACT
JMFS109F03+ CTCATATGTAATGTAACGTCTTGAATATTAGCATACAATACAGTAATCAACCACTGCAAA
JMSF042A14+ CTCATATGTAATGTAACGTCTTGAATATTAGCATACAATACAGTAATCAACCACTGCAAA
                      ____________________________________________________________
consensus CTCATATGTAATGTAACGTCTTGAATATTAGCATACAATACAGTAATCAACCACTGCAAA
 
. : . : . : . : . : . :
JMFS109F03+ TTTTATAATTTTTTTTGTTGAAAAATGGGGATAGAAGCAGTTGGGAGAGGGTGATTCTGT
JMSF042A14+ TTTTATAATTTTTTTTGTTGAAAAATGGGGATAGAAGCAGTTGGGAGAGGGTGATTCTGT
                      ____________________________________________________________
consensus TTTTATAATTTTTTTTGTTGAAAAATGGGGATAGAAGCAGTTGGGAGAGGGTGATTCTGT
 
. : . : . : . : . : . :
JMFS109F03+ GTTTGTGTAAGGGAGGGAGGGTTTCTTA
JMSF042A14+ GTTTGTGTAAGGGAGGGAGGGTTTCTTACAGATTAGGAACGAGAGGTGGCTGTTGGTACC
                      ____________________________________________________________
consensus GTTTGTGTAAGGGAGGGAGGGTTTCTTACAGATTAGGAACGAGAGGTGGCTGTTGGTACC