Previous Contig 007462:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051M08Sequence644007462 (11)gb:AY064031_15659696e-44Arabidopsis thaliana unknown protein (At2g26970) mRNA, complete cds.>gb:BT001963379007462 (11)
JMFN041O24Sequence512007462 (11)gb:AY064031_15659692e-35Arabidopsis thaliana unknown protein (At2g26970) mRNA, complete cds.>gb:BT001963
JMSF019D23Sequence208007462 (11)743007462 (11)gb:AY064031_15659692e-63Arabidopsis thaliana unknown protein (At2g26970) mRNA, complete cds.>gb:BT001963
JMSF042A11Sequence360007462 (11)305007462 (11)
JMSF042B11Sequence360007462 (11)305007462 (11)
JMSF043B11Sequence360007462 (11)306007462 (11)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF051M08- ACCCTGGAGAGTTTTTTTTTTTTTTTTGAAA
                      ____________________________________________________________
consensus ACCCTGGAGAGTTTTTTTTTTTTTTTTGAAA
 
. : . : . : . : . : . :
rJMFF051M08- TACTGAAATGCAATACACTTAGTTAAAATACTGAAATTCACACTGTTAGGGGAATCTAGC
rJMSF019D23- GTTAGGGGAATCTAGC
                      ____________________________________________________________
consensus TACTGAAATGCAATACACTTAGTTAAAATACTGAAATTCACACTGTTAGGGGAATCTAGC
 
. : . : . : . : . : . :
rJMFF051M08- AAAGCAAATGTTGGCAGCAACCAGCATAAATACTACAGCATATTAGAGAAATGATGTATG
JMFN041O24+ GGCAGCAACCAGCATAAATACTACAGCATATTAGAGAAATGATGTATG
rJMSF019D23- AAAGCAAATGTTGGCAGCAACCAGCATAAATACTACAGCATATTAGAGAAATGATGTATG
                      ____________________________________________________________
consensus AAAGCAAATGTTGGCAGCAACCAGCATAAATACTACAGCATATTAGAGAAATGATGTATG
 
. : . : . : . : . : . :
rJMFF051M08- CCTTGTCCACTTGCCACAGCAAAGCATAGTAGCATGATAGGTTATGGAGAGGTCGATGTT
JMFN041O24+ CCTTGTCCACTTGCCACAGCAAAGCATAGTAGCATGATAGGTTATGGAGAGGTCGATGTT
rJMSF019D23- CCTTGTCCACTTGCCACAGCAAAGCATAGTAGCATGATAGGTTATGGAGAGGTCGATGTT
                      ____________________________________________________________
consensus CCTTGTCCACTTGCCACAGCAAAGCATAGTAGCATGATAGGTTATGGAGAGGTCGATGTT
 
. : . : . : . : . : . :
rJMFF051M08- AAGAAGTCTGTACCACTATACAGGGAAGGGAATACCATATTTCTGAGAAGGGGCATCGCG
JMFN041O24+ AAGAAGTCTGTACCACTATACAGGGAAGGGAATACCATATTTCTGAGAAGGGGCATCGCG
rJMSF019D23- AAGAAGTCTGTACCACTATACAGGGAAGGGAATACCATATTTCTGAGAAGGGGCATCGCG
                      ____________________________________________________________
consensus AAGAAGTCTGTACCACTATACAGGGAAGGGAATACCATATTTCTGAGAAGGGGCATCGCG
 
. : . : . : . : . : . :
rJMFF051M08- CAATACCATACTTTCGCCATTACATAGTTGATAACCTTACGTAATTACCTCCTAGACTTG
JMFN041O24+ CAATACCATACTTTCGCCATTACATAGTTGATAACCTTACGTAATTACCTCCTAGACTTG
rJMSF019D23- CAATACCATACTTTCGCCATTACATAGTTGATAACCTTACGTAATTACCTCCTAGACTTG
                      ____________________________________________________________
consensus CAATACCATACTTTCGCCATTACATAGTTGATAACCTTACGTAATTACCTCCTAGACTTG
 
. : . : . : . : . : . :
rJMFF051M08- GAGGATTTAAAAATGTGCTCCTTGTAGTATTTGAGCTCTGCTATGCTC
JMFN041O24+ GAGGATTTAAAAATGTGCTCCTTGTAGTATTTGAGCTCTGCTATGCTCTCCTTAATGTCA
rJMSF019D23- GAGGATTTAAAAATGTGCTCCTTGTAGTATTTGAGCTCTGCTATGCTCTCCTTAATGTCA
                      ____________________________________________________________
consensus GAGGATTTAAAAATGTGCTCCTTGTAGTATTTGAGCTCTGCTATGCTCTCCTTAATGTCA
 
. : . : . : . : . : . :
JMFN041O24+ TCCATAGCTCTATGCTTGTTTTCCTTTCGAGGAGCCTTTTTGTTGTCTCTGGGGAACCAC
rJMSF019D23- TCCATAGCTCTATGCTTGTTTTCCTTTCGAGGAGCCTTTTTGTTGTCTCTGGGGAACCAC
                      ____________________________________________________________
consensus TCCATAGCTCTATGCTTGTTTTCCTTTCGAGGAGCCTTTTTGTTGTCTCTGGGGAACCAC
 
. : . : . : . : . : . :
JMFN041O24+ CGAACACATAATGCCTTGACACTACTGACATCGACAAGTACATGGGAGAAAAGACTAGCC
rJMSF019D23- CGAACACATAATGCCTTGACACTACTGACATCGACAAGTACATGGGAGAAAAGACTAGCC
                      ____________________________________________________________
consensus CGAACACATAATGCCTTGACACTACTGACATCGACAAGTACATGGGAGAAAAGACTAGCC
 
. : . : . : . : . : . :
JMFN041O24+ AGATCGGGCATGTACTTCTTCAAGAAGATGAAATCAACATAAACTGAATTCCCAGCAAGG
rJMSF019D23- AGATCGGGCATGTACTTCTTCAAGAAGATGAAATCAACATAAACTGAATTCCCAGCAAGG
JMFF051M08+ GAAGATGAAATCACCATAAACTGAATTCCCAGCAAGG
                      ____________________________________________________________
consensus AGATCGGGCATGTACTTCTTCAAGAAGATGAAATCAACATAAACTGAATTCCCAGCAAGG
 
. : . : . : . : . : . :
JMFN041O24+ AGGGGTGAATAAGTGCCAACATTTCTCTTCACAAATTCCACAAC
rJMSF019D23- AGGGGTGAATAAGTGCCAACATTTCTCTTCACAAATTCCACAACCTGATTCTCAGCTTCT
JMFF051M08+ AGGGGTGAATAAGTGCCAACATTTCTCTTCACAAATTCCACAACCTGATTCTCAGCTTCT
                      ____________________________________________________________
consensus AGGGGTGAATAAGTGCCAACATTTCTCTTCACAAATTCCACAACCTGATTCTCAGCTTCT
 
. : . : . : . : . : . :
rJMSF019D23- TTAACAGTGATTGTACTTTCAAGCACCTTTTCAGTCAGACTGCTTGCTGCATGATGCTCT
JMFF051M08+ TTAACAGTGATTGTACTTTCAAGCACCTTTTCAGTCAGACTGCTTGCTGCATGATGCTCT
                      ____________________________________________________________
consensus TTAACAGTGATTGTACTTTCAAGCACCTTTTCAGTCAGACTGCTTGCTGCATGATGCTCT
 
. : . : . : . : . : . :
rJMSF019D23- TGACACCATTCTCCCATATTATCTAGACACTCCTTTGGTTGATGAATAACCAAATCAGGT
JMFF051M08+ TGACACCATTCTCCCATATTATCTAGACACTCCTTTGGTTGATGAATAACCAAATCAGGT
                      ____________________________________________________________
consensus TGACACCATTCTCCCATATTATCTAGACACTCCTTTGGTTGATGAATAACCAAATCAGGT
 
. : . : . : . : . : . :
rJMSF019D23- CCCTCAATTGATTTGGTTAAACGTCCATCAGTGATCACACAAGCAATCTCCAATATCCTG
JMFF051M08+ CCCTCAATTGATTTGGTTAAACGTCCATCAGTGATCACACAAGCAATCTCCAATATCCTG
                      ____________________________________________________________
consensus CCCTCAATTGATTTGGTTAAACGTCCATCAGTGATCACACAAGCAATCTCCAATATCCTG
 
. : . : . : . : . : . :
rJMSF019D23- TCTACTT
JMFF051M08+ TCTACTTCAACATTCAAACCAGTCATTTCAAGGTCAATCCATACAAGCGGCAACTTGTAC
                      ____________________________________________________________
consensus TCTACTTCAACATTCAAACCAGTCATTTCAAGGTCAATCCATACAAGCGGCAACTTGTAC
 
. : . : . : . : . : . :
JMFF051M08+ TCCTCACCGCTATCATCATCTTTTAGCTTTGTCACCTCTCCTGAGCAGTTTTCTTCTTTA
                      ____________________________________________________________
consensus TCCTCACCGCTATCATCATCTTTTAGCTTTGTCACCTCTCCTGAGCAGTTTTCTTCTTTA
 
. : . : . : . : . : . :
JMFF051M08+ TTTTCTTTTCCATTTTCTTTGGACACTACTGCTGTATCCTCTTGACTATCAGCAACATCC
JMSF043B11+ TTTTTTCCATTTTCTTTGGACACTACTGCTGTATCCTCTTGACTATCAGCAACATCC
rJMSF042B11- ACATCC
rJMSF042A11- ACATCC
rJMSF043B11- ACATCC
JMSF019D23+ ACTATCAGCAACATCC
JMSF042B11+ TTTTTTCCATTTTCTTTGGACACTACTGCTGTATCCTCTTGACTATCAGCAACATCC
JMSF042A11+ TTTTCCATTTTCTTTGGACACTNCNGCTGTATCCTCTTGACTATCAGCAACATCC
                      ____________________________________________________________
consensus TTTTTTTTTCCATTTTCTTTGGACACTACTGCTGTATCCTCTTGACTATCAGCAACATCC
 
. : . : . : . : . : . :
JMFF051M08+ AAATTCAGCAACGAAAAGGTATTAGCGAG-TTCATTCATTTTCAAAGCAGTGGCTGAACA
JMSF043B11+ AAATTCAGCAACGAAAAGGTATTAGCGAG-TTCATTCATTTTCAAAGCAGTGGCTGAACA
rJMSF042B11- AAATTCAGCAACGAAAAGGTATTAGCGAG-TTCATTCATTTTCAAAGCAGTGGCTGAACA
rJMSF042A11- AAATTCAGCAACGAAAAGGTATTAGCGAG-TTCATTCATTTTCAAAGCAGTGGCTGAACA
rJMSF043B11- AAATTCAGCAACGAAAAGGTATTAGCGAGCTTCATTCATTTTCAAAGCAGTGGCTGAACA
JMSF019D23+ AAATTCAGCAACGAAAAGGTATTAGCGAG-TTCATTCATTTTCAAAGCAGTGGCTGAACA
JMSF042B11+ AAATTCAGCAACGAAAAGGTATTAGCGAG-TTCATTCATTTTCAAAGCAGTGGCTGAACA
JMSF042A11+ AAATTCAGCAACGAAAAGGTATTAGCGAG-TTCATTCATTTTCAAAGCAGTGGCTGAACA
                      ____________________________________________________________
consensus AAATTCAGCAACGAAAAGGTATTAGCGAG-TTCATTCATTTTCAAAGCAGTGGCTGAACA
 
. : . : . : . : . : . :
JMFF051M08+ TTAAGCTCCCCGAAAATTCACATCCACCAGATCACCAATGACTCTTCAATACCTGCAAGC
JMSF043B11+ TTAAGCTCCCCGAAAATTCACATCCACCAGATCACCAATGACTCTTCAATACCTGCAAGC
rJMSF042B11- TTAAGCTCCCCGAAAATTCACATCCACCAGATCACCAATGACTCTTCAATACCTGCAAGC
rJMSF042A11- TTAAGCTCCCCGAAAATTCACATCCACCAGATCACCAATGACTCTTCAATACCTGCAAGC
rJMSF043B11- TTAAGCTCCCCGAAAATTCACATCCACCAGATCACCAATGACTCTTCAATACCTGCAAGC
JMSF019D23+ TTAAGCTCCCCGAAAATTCACATCCACCAGATCACCAATGACTCTTCAATACCTGCAAGC
JMSF042B11+ TTAAGCTCCCCGAAAATTCACATCCACCAGATCACCAATGACTCTTCAATACCTGCAAGC
JMSF042A11+ TTAAGCTCCCCGAAAATTCACATCCACCAGATCACCAATGACTNTTCAATACCTGCAAGC
                      ____________________________________________________________
consensus TTAAGCTCCCCGAAAATTCACATCCACCAGATCACCAATGACTCTTCAATACCTGCAAGC
 
. : . : . : . : . : . :
JMFF051M08+ ACCAGCCAAGCCGTCGGTGGTGGTGCGAGGGGCGGAGGAGAGATGCAGCGGAGCCGGAAG
JMSF043B11+ ACCAGCCAAGCCGTCGGTGGTGGTGCGAGGGGCGGAGGAGAGATGCAGCGGAGCCGGAAG
rJMSF042B11- ACCAGCCAAGCCGTCGGTGGTGGTGCGAGGGGCGGAGGAGAGATGCAGCGGAGCCGGAAG
rJMSF042A11- ACCAGCCAAGCCGTCGGTGGTGGTGCGAGGGGCGGAGGAGAGATGCAGCGGAGCCGGAAG
rJMSF043B11- ACCAGCCAAGCCGTCGGTGGTGGTGCGAGGGGCGGAGGAGAGATGCAGCGGAGCCGGAAG
JMSF019D23+ ACCAGCCAAGCCGTCGGTGGTGGTGCGAGGGGCGGAGGAGAGATGCAGCGGAGCCGGAAG
JMSF042B11+ ACCAGCCAAGCCGTCGGTGGTGGTGCGAGGGGCGGAGGAGAGATGCAGCGGAGCCGGAAG
JMSF042A11+ ACCAGCCAAGCCGTCGGTGGTGGTGCGAGGGGCGGAGGAGAGATGCAGCGGAGCCGGAAG
                      ____________________________________________________________
consensus ACCAGCCAAGCCGTCGGTGGTGGTGCGAGGGGCGGAGGAGAGATGCAGCGGAGCCGGAAG
 
. : . : . : . : . : . :
JMFF051M08+ TGTCGAAT
JMSF043B11+ TGTCGAATGCTTCGAATCTTTGGACAGATAATTTCTGTTTTATACTGTACTACAATTAGT
rJMSF042B11- TGTCGAATGCTTCGAATCTTTGGACAGATAATTTCTGTTTTATACTGTACTACAATTAGT
rJMSF042A11- TGTCGAATGCTTCGAATCTTTGGACAGATAATTTCTGTTTTATACTGTACTACAATTAGT
rJMSF043B11- TGTCGAATGCTTCGAATCTTTGGACAGATAATTTCTGTTTTATACTGTACTACAATTAGT
JMSF019D23+ TGTCGAATGCTTC
JMSF042B11+ TGTCGAATGCTTCGAATCTTTGGACAGATAATTTCTGTTTTATACTGTACTACAATTAGT
JMSF042A11+ TGTCGAATGCTTCGAATCTTCGGACAGATAATTTCTGTTTTATACTGTACTACAATTAGT
                      ____________________________________________________________
consensus TGTCGAATGCTTCGAATCTTTGGACAGATAATTTCTGTTTTATACTGTACTACAATTAGT
 
. : . : . : . : . : . :
JMSF043B11+ GAGTCAGTTTTACTTTCGCCGGATTTTTCGCCCCATTTCTATCCTTTACGAAAGTTCTGC
rJMSF042B11- GAGTCAGTTTTACTTTCGCCGGATTTTTCGCCCCATTTCTATCCTTTACGAAAGTTCTGC
rJMSF042A11- GAGTCAGTTTTACTTTCGCCGGATTTTTCGCCCCATTTCTATCCTTTACGAAAGTTCTGC
rJMSF043B11- GAGTCAGTTTTACTTTCGCCGGATTTTTCGCCCCATTTCTATCCTTTACGAAAGTTCTGC
JMSF042B11+ GAGTCAGTTTTACTTTCGCCGGATTTTTCGCCCCATTTCTATCCTTTACGAAAGTTCTGC
JMSF042A11+ GAGTCAGTTTTACTTTCGCCGGATTTTTCGCCCCATTTCTATCCTTTACGAAAGTTCTGC
                      ____________________________________________________________
consensus GAGTCAGTTTTACTTTCGCCGGATTTTTCGCCCCATTTCTATCCTTTACGAAAGTTCTGC