Previous Contig 007456:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS120C05Sequence625007456 (4)gb:AY062529_15651851e-52Arabidopsis thaliana Unknown protein mRNA, complete cds.>gb:BT000128_1634406 Ara
JMSF017N23Sequence263007456 (4)742013385 (4)
JMSF024O02Sequence621007456 (4)gb:AY062529_15651852e-10Arabidopsis thaliana Unknown protein mRNA, complete cds.>gb:BT000128_1634406 Ara683013385 (4)gb:AY062529_15651853e-16Arabidopsis thaliana Unknown protein mRNA, complete cds.>gb:BT000128_1634406 Ara
JMSF041P05Sequence573007456 (4)644013385 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS120C05+ GTCAAGTCATCATTTGCTTTAATGAC
                      ____________________________________________________________
consensus GTCAAGTCATCATTTGCTTTAATGAC
 
. : . : . : . : . : . :
JMFS120C05+ CTGATGAAGATCAGACTCCATGAGTTCAAAAACTACATATATGTCCTTGAATTCCCTTCG
                      ____________________________________________________________
consensus CTGATGAAGATCAGACTCCATGAGTTCAAAAACTACATATATGTCCTTGAATTCCCTTCG
 
. : . : . : . : . : . :
JMFS120C05+ AGAAGGAGGCAGTAAGATGTGCTTGATTTCCACTATATCTGGATGGCGAAGAAGTCTAAG
                      ____________________________________________________________
consensus AGAAGGAGGCAGTAAGATGTGCTTGATTTCCACTATATCTGGATGGCGAAGAAGTCTAAG
 
. : . : . : . : . : . :
JMFS120C05+ AAGCTTAATCTCCCGAAGGATACGTGTTGCATCCGAGACATGCTCGAAGATATCATTTAT
                      ____________________________________________________________
consensus AAGCTTAATCTCCCGAAGGATACGTGTTGCATCCGAGACATGCTCGAAGATATCATTTAT
 
. : . : . : . : . : . :
JMFS120C05+ CTTTTTAATTGCAACTTTCTCACCAAGATATGTATCATATGCGGAGCATACAACTCCATA
JMSF024O02+ AGATATGTATCATATGCGGAGCATACAACTCCATA
                      ____________________________________________________________
consensus CTTTTTAATTGCAACTTTCTCACCAAGATATGTATCATATGCGGAGCATACAACTCCATA
 
. : . : . : . : . : . :
JMFS120C05+ GCTACCTTTTCCAATTACTTCTTCTATTCTGTATCTGCTACCCTCACCATATTCTGTGAA
JMSF024O02+ GCTACCTTNTCCANTTACTTCTTNTATTCTGTATCTGCTACCCTCACCATATTCTGTGAA
                      ____________________________________________________________
consensus GCTACCTTTTCCAATTACTTCTTCTATTCTGTATCTGCTACCCTCACCATATTCTGTGAA
 
. : . : . : . : . : . :
JMSF017N23+ TGATCAGGCTGCATATCTTGTACATAAAA
JMFS120C05+ GAAATCTACATCTGCAGATGCCTTTCTCCGCTGATCAGGCTGCATATCTTGTACATAAAA
JMSF024O02+ GAAATCTACATCTGCAGATGCCTTTCTCCGATGATCAGGCTGCATATCTTGTACATAAAA
                      ____________________________________________________________
consensus GAAATCTACATCTGCAGATGCCTTTCTCCGCTGATCAGGCTGCATATCTTGTACATAAAA
 
. : . : . : . : . : . :
JMSF017N23+ GCATGAAAATACCGAATCTTAGCTATCTAAAGCAGAGATTAGATCGCAGAAAGGGTATAA
JMFS120C05+ GCATGAAAATACCGAATCTTAGCTATCTAAAGCAGAGATTAGATCGCAGAAAGGGTATAA
JMSF024O02+ GCATGAAAATACCGAATCTTAGCTATCTAAAGCAGAGATTAGATCGCAGAAAGGGTATGA
                      ____________________________________________________________
consensus GCATGAAAATACCGAATCTTAGCTATCTAAAGCAGAGATTAGATCGCAGAAAGGGTATAA
 
. : . : . : . : . : . :
JMSF017N23+ AGAGTTTGACTTCAACAAAAAGACAAACACTTTGAAGAATCAAAACCCC----------A
JMFS120C05+ AGAGTTTGACTTCAACAAAAAGACAAACACTTTGAAGAATCAAAACCCC----------A
JMSF024O02+ AGAGTTTGACTTCAAC-AAAAGACAAACAC-CTGAAGAATCAAAACCCCAGAACTCAAAA
                      ____________________________________________________________
consensus AGAGTTTGACTTCAACAAAAAGACAAACACTTTGAAGAATCAAAACCCC----------A
 
. : . : . : . : . : . :
JMSF017N23+ GATAAAAAATAAACCGAATAACCGCAGCAACAATGAATTCAGTCAGAACCGATCTTCTGG
JMFS120C05+ GATAAAAAATAAACCGAATAACCGCAGCAACAATGAATTCAGTCAGAACCGATCTTCTGG
JMSF024O02+ GATAAAAAATAAACCGAATAACCGCAGCAACAATCAATTCACTCAGAACCGATCTTCTGG
                      ____________________________________________________________
consensus GATAAAAAATAAACCGAATAACCGCAGCAACAATGAATTCAGTCAGAACCGATCTTCTGG
 
. : . : . : . : . : . :
JMSF017N23+ CAAAAAGTGAAACCCAAAAATGAGGCG
JMFS120C05+ CAAAAAGTGAAACCCAAAAATGAGGCG
JMSF024O02+ CAAAAAGTGAAACCCAAAAATGAGGCGGAGCAAGGGAGACGGAGTGGAAAAATGGGATGC
                      ____________________________________________________________
consensus CAAAAAGTGAAACCCAAAAATGAGGCGGAGCAAGGGAGACGGAGTGGAAAAATGGGATGC
 
. : . : . : . : . : . :
JMSF024O02+ CGGAAACTGTAAAAGAAGTCAGGATAAAATTGAAAAGCTATGTTCTGGGTCTGCAACTAT
JMSF041P05+ GGAAACTGTAAAAGAAGTCAGGATAAAATTGAAAAGCTATGTTCTGGGTCTGCAACTAT
                      ____________________________________________________________
consensus CGGAAACTGTAAAAGAAGTCAGGATAAAATTGAAAAGCTATGTTCTGGGTCTGCAACTAT
 
. : . : . : . : . : . :
JMSF024O02+ TTTTATAG---TGATACACATTTGGATGGCAGCGAGATTCTTGGAAAAAGTGAATATGAA
JMSF041P05+ TTTTATAGTGATGATACACATTTGGATGGCAGCGAGATTCTTGGAAAAAGTGAATATGAA
                      ____________________________________________________________
consensus TTTTATAGTGATGATACACATTTGGATGGCAGCGAGATTCTTGGAAAAAGTGAATATGAA
 
. : . : . : . : . : . :
JMSF024O02+ TNTGATA------------TAACAGCTGGAAAACAGACAGGGC-TTTCCTTAAATGATCC
JMSF041P05+ TATGATATATACGCAGAAGTAACAGCTGGAAAACAGACAGGGCTTTTCCTTAAATGATCC
                      ____________________________________________________________
consensus TATGATATATACGCAGAAGTAACAGCTGGAAAACAGACAGGGCTTTTCCTTAAATGATCC
 
. : . : . : . : . : . :
JMSF024O02+ AGCACCAAAGAAAATGGGCGGCGATGATCTCTATTCTCTAGTGTCTTTGCAACAGCCAAC
JMSF041P05+ AGCACCAAAGAAAATGGGCGGCGATGATCTCTATTCTCTAGTGTCTTTGCAACAGCCAAC
                      ____________________________________________________________
consensus AGCACCAAAGAAAATGGGCGGCGATGATCTCTATTCTCTAGTGTCTTTGCAACAGCCAAC
 
. : . : . : . : . : . :
JMSF024O02+ AAT
JMSF041P05+ AATGCAAAAGAAAAGAACTACTCCGTAGGCAAATTAAAGGCAAAGGGTATCCTAATCTAT
                      ____________________________________________________________
consensus AATGCAAAAGAAAAGAACTACTCCGTAGGCAAATTAAAGGCAAAGGGTATCCTAATCTAT
 
. : . : . : . : . : . :
JMSF041P05+ CACCCCCTCAGTCCCTGTCAATGGTTAACCAACATAGAAAGAGAGTAAATGCTGCCAGCC
                      ____________________________________________________________
consensus CACCCCCTCAGTCCCTGTCAATGGTTAACCAACATAGAAAGAGAGTAAATGCTGCCAGCC