Previous Contig 007453:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014N21Sequence502007453 (4)gb:AK176467_18184552e-40Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-25-I19.736008896 (3)gb:AP004159_18383772e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMFF015O14Sequence588007453 (4)gb:AK176467_18184551e-44Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-25-I19.
JMSF033L16Sequence584007453 (4)gb:AK176467_18184551e-40Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-25-I19.706008896 (3)gb:AP004159_18383773e-69Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11
JMSF041O13Sequence788007453 (4)gb:AK176467_18184551e-52Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-25-I19.591008896 (3)gb:AP004159_18383772e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041O13+ GAAGATTG
                      ____________________________________________________________
consensus GAAGATTG
 
. : . : . : . : . : . :
JMFF015O14+ TTCTCAAGGGC
JMSF041O13+ TGTGGGAACATTTTTGGGCTGTGCAGCACTCAACCTCACATTCACAATCTTCTCAAGGGC
                      ____________________________________________________________
consensus TGTGGGAACATTTTTGGGCTGTGCAGCACTCAACCTCACATTCACAATCTTCTCAAGGGC
 
. : . : . : . : . : . :
JMSF033L16+ CATGGTGGTGTCNTCAATTATCTTNTGCAACTCATCACTGTCCATCTC
JMFF015O14+ TGCTTTCGTCTCCATGGTGGTGTCCTCAATTATCTTCTGCAACTCATCACTGTCCATCTC
JMSF041O13+ TGCTTTCGTCTCCATGGTGGTGTCCTCAATTATCTTCTGCAACTCATCACTGTCCATCTC
                      ____________________________________________________________
consensus TGCTTTCGTCTCCATGGTGGTGTCCTCAATTATCTTCTGCAACTCATCACTGTCCATCTC
 
. : . : . : . : . : . :
JMSF033L16+ TTCATCGTCTTCATCATCTTTCACAACCTTGGGAATAAGGTCTTTATGCTGAGAATACAC
JMFF015O14+ TTCATCGTCTTCATCATCTTTCACAACCTTGGGAATAAGGTCTTTATGCTGAGAATACAC
JMFF014N21+ TGGGAATAAGGTCTTTATGCTGAGAATACAC
JMSF041O13+ TTCATCGTCTTCATCATCTTTCACAACCTTGGGAATAAGGTCTTTATGCTGAGAATACAC
                      ____________________________________________________________
consensus TTCATCGTCTTCATCATCTTTCACAACCTTGGGAATAAGGTCTTTATGCTGAGAATACAC
 
. : . : . : . : . : . :
JMSF033L16+ AATTTTCTTNGAATTTTCATTNTGCTTCACAATTGCATCATATCTCACATCACCATGCTC
JMFF015O14+ AATTTTCTTTGAATTTTCATTCTGCTTCACAATTGCATCATATCTCACATCACCATGCTC
JMFF014N21+ AATTTTCTTTGAATTTTCATTCTGCTTCACAATTGCATCATATCTCACATCACCATGCTC
JMSF041O13+ AATTTTCTTTGAATTTTCATTCTGCTTCACAATTGCATCATATCTCACATCACCATGCTC
                      ____________________________________________________________
consensus AATTTTCTTTGAATTTTCATTCTGCTTCACAATTGCATCATATCTCACATCACCATGCTC
 
. : . : . : . : . : . :
JMSF033L16+ ATCAACAGTAACAGGTAATGTCTTGTTCGCAGGTTTCCAGTCCTTTTTTCTCCCCATATC
JMFF015O14+ ATCAACAGTAACAGGTAATGTCTTGTTCGCAGGTTTCCAGTCCTTTTTTCTCCCCATATC
JMFF014N21+ ATCAACAGTAACAGGTAATGTCTTGTTCGCAGGTTTCCAGTCCTTTTTTCTCCCCATATC
JMSF041O13+ ATCAACAGTAACAGGTAATGTCTTGTTCGCAGGTTTCCAGTCCTTTTTTCTCCCCATATC
                      ____________________________________________________________
consensus ATCAACAGTAACAGGTAATGTCTTGTTCGCAGGTTTCCAGTCCTTTTTTCTCCCCATATC
 
. : . : . : . : . : . :
JMSF033L16+ AAGAGGATACTGTGCATAATGAATTTCAGGGAATGCACCTCCATCCCCAAAATCCTCAAG
JMFF015O14+ AAGAGGATACTGTGCATAATGAATTTCAGGGAATGCACCTCCATCCCCAAAATCCTCAAG
JMFF014N21+ AAGAGGATACTGTGCATAATGAATTTCAGGGAATGCACCTCCATCCCCAAAATCCTCAAG
JMSF041O13+ AAGAGGATACTGTGCATAATGAATTTCAGGGAATGCACCTCCATCCCCAAAATCCTCAAG
                      ____________________________________________________________
consensus AAGAGGATACTGTGCATAATGAATTTCAGGGAATGCACCTCCATCCCCAAAATCCTCAAG
 
. : . : . : . : . : . :
JMSF033L16+ CTTAGATGGCCTAAATCCAGCCCTTTTCATATAAGGGGGCACTGGGTTTGCCTTGATAAC
JMFF015O14+ CTTAGATGGCCTAAATCCAGCCCTTTTCATATAAGGGGGCACTGGGTTTGCCTTGATAAC
JMFF014N21+ CTTAGATGGCCTAAATCCAGCCCTTTTCATATAAGGGGGCACTGGGTTTGCCTTGATAAC
JMSF041O13+ CTTAGATGGCCTAAATCCAGCCCTTTTCATATAAGGGGGCACTGGGTTTGCCTTGATAAC
                      ____________________________________________________________
consensus CTTAGATGGCCTAAATCCAGCCCTTTTCATATAAGGGGGCACTGGGTTTGCCTTGATAAC
 
. : . : . : . : . : . :
JMSF033L16+ TGCATTTTTCTCTTCCTCAGCACCACTATATCTGTTCTTAAACCATGGATCATTTGTGTG
JMFF015O14+ TGCATTTTTCTCTTCCTCAGCACCACTATATCTGTTCTTAAACCATGGATCATTTGTGTG
JMFF014N21+ TGCATTTTTCTCTTCCTCAGCACCACTATATCTGTTCTTAAACCATGGATCATTTGTGTG
JMSF041O13+ TGCATTTTTCTCTTCCTCAGCACCACTATATCTGTTCTTAAACCATGGATCATTTGTGTG
                      ____________________________________________________________
consensus TGCATTTTTCTCTTCCTCAGCACCACTATATCTGTTCTTAAACCATGGATCATTTGTGTG
 
. : . : . : . : . : . :
JMSF033L16+ GTCATAATGCGTAGCACTACTTGACTTTACTTGTGGTAGAAGGTCCCTCAGAGTAGCCAT
JMFF015O14+ GTCATAATGCGTAGCACTACTTGACTTTACTTGTGGTAGAAGGTCCCTCAGAGTAGCCAT
JMFF014N21+ GTCATAATGCGTAGCACTACTTGACTTTACTTGTGGTAGAAGGTCCCTCAGAGTAGCCAT
JMSF041O13+ GTCATAATGCGTAGCACTACTTGACTTTACTTGTGGTAGAAGGTCCCTCAGAGTAGCCAT
                      ____________________________________________________________
consensus GTCATAATGCGTAGCACTACTTGACTTTACTTGTGGTAGAAGGTCCCTCAGAGTAGCCAT
 
. : . : . : . : . : . :
JMSF033L16+ GCTGGGAGGCGAAGACTTTAAC
JMFF015O14+ GCTGGGAGGCGAAGACTTTAACCTG
JMFF014N21+ GCTGGGAGGCGAAGACTTTAACCTGCACCAAATGCTGA
JMSF041O13+ GCTGGGAGGCGAAGACTTTAACCTGCACCAAATGCTGAACTATAAACCCAGAATTGAGAC
                      ____________________________________________________________
consensus GCTGGGAGGCGAAGACTTTAACCTGCACCAAATGCTGAACTATAAACCCAGAATTGAGAC
 
. : . : . : . : . : . :
JMSF041O13+ CTGGACAATGTAAAACCTTTATGATTCAAGGGACAAAACCCTAGGCCACGAAACGCAACT
                      ____________________________________________________________
consensus CTGGACAATGTAAAACCTTTATGATTCAAGGGACAAAACCCTAGGCCACGAAACGCAACT
 
. : . : . : . : . : . :
JMSF041O13+ CTAAATCTGATCTGAGCTGATCTGAGCTAATAAGACCGCACGGCTAGTTGTCTTCTCCGA
                      ____________________________________________________________
consensus CTAAATCTGATCTGAGCTGATCTGAGCTAATAAGACCGCACGGCTAGTTGTCTTCTCCGA
 
. : . : . : . : . : . :
JMSF041O13+ GCAGGATAAGGAAAGCCATTTGCGGAGGGATTGTTTGGTCTGCAGTATTTATTGCGCCCC
                      ____________________________________________________________
consensus GCAGGATAAGGAAAGCCATTTGCGGAGGGATTGTTTGGTCTGCAGTATTTATTGCGCCCC