Previous Contig 007450:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS109G09Sequence624007450 (2)pir|T50794|T507941e-10hypothetical protein T30N20_120 - Arabidopsis thaliana>gb:ATT30N20_1555803 Arabi
JMSF041N21Sequence468007450 (2)608013379 (2)gb:AP002032_18214927e-09Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPH15.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS109G09+ AA
                      ____________________________________________________________
consensus AA
 
. : . : . : . : . : . :
JMFS109G09+ TCCAAGCCAACAGCTTCTCCAATTTATCAGTTCTTGAGTCGAAATTGGGTCTCCATAGCT
                      ____________________________________________________________
consensus TCCAAGCCAACAGCTTCTCCAATTTATCAGTTCTTGAGTCGAAATTGGGTCTCCATAGCT
 
. : . : . : . : . : . :
JMFS109G09+ GCGTTGTGAGATAGTGATCAAGGACCATCCAGGGACCCCCAAATTTGATGGCGTCGTAAT
                      ____________________________________________________________
consensus GCGTTGTGAGATAGTGATCAAGGACCATCCAGGGACCCCCAAATTTGATGGCGTCGTAAT
 
. : . : . : . : . : . :
JMFS109G09+ CGGTTAGGGATTCGAATTTCGCCAGGAAATAGTCGTGGTTTAGGGCTATCAGTTCAAAAG
                      ____________________________________________________________
consensus CGGTTAGGGATTCGAATTTCGCCAGGAAATAGTCGTGGTTTAGGGCTATCAGTTCAAAAG
 
. : . : . : . : . : . :
JMFS109G09+ GCGCTTCAGTTTTCCACATTCTTTGGAGACGCTGGAATAGATAGGAATAACCCACAGTTC
JMSF041N21+ TCCACATTCTTTGGAGACGCTGGAATAGATAGGAATAACCCACAGTTC
                      ____________________________________________________________
consensus GCGCTTCAGTTTTCCACATTCTTTGGAGACGCTGGAATAGATAGGAATAACCCACAGTTC
 
. : . : . : . : . : . :
JMFS109G09+ TTCCAAGAATATTGATAATCAACGAACCTACGCCAGGGACGCCTCAGTCTCTTCTTCTCC
JMSF041N21+ TTCCAAGAATATTGATAATCAACGAACNTACGCCAGGGACGCCTCAGTCTCTTNTTCTCC
                      ____________________________________________________________
consensus TTCCAAGAATATTGATAATCAACGAACCTACGCCAGGGACGCCTCAGTCTCTTCTTCTCC
 
. : . : . : . : . : . :
JMFS109G09+ TCCTTAGTGACCTTGATGACCGGATAATCAAATGACCTGCCATCCTCCTCCATATCATCA
JMSF041N21+ TCCTTAGTGACCTTGATGACCGGATAATCAAANGACCNGCCATCCTCCTCCATATCATCA
                      ____________________________________________________________
consensus TCCTTAGTGACCTTGATGACCGGATAATCAAATGACCTGCCATCCTCCTCCATATCATCA
 
. : . : . : . : . : . :
JMFS109G09+ TTAGAATCAACCTCAACCACCGGCGCACGATCCGGGATGTGGATAGGGGTTGCCAATGGC
JMSF041N21+ TTAGAATCAACCTCAACCACCGGCGCNCGATCCGGGATGNGGATAGGGGTTGCCAATGGC
                      ____________________________________________________________
consensus TTAGAATCAACCTCAACCACCGGCGCACGATCCGGGATGTGGATAGGGGTTGCCAATGGC
 
. : . : . : . : . : . :
JMFS109G09+ GTTCTCCAATGGTTTGAATCGGGTCTATTTCCCCTCGTCACAGCAGGGGAGTCTTGGCCC
JMSF041N21+ GTTCTCCAATGGTTTGAATCGGGTNTATTTCCCCTCGTCACAGCAGGGGAGTCTTGGCCC
                      ____________________________________________________________
consensus GTTCTCCAATGGTTTGAATCGGGTCTATTTCCCCTCGTCACAGCAGGGGAGTCTTGGCCC
 
. : . : . : . : . : . :
JMFS109G09+ AGATTATCGTTCAGCGATGACATCGCAGCTTGTAAGTAATCTCGACCTCTTTTGGTTTTC
JMSF041N21+ AGATTATCGTTCAGCGATGACATNGCAGCNTGTAAGTAATCTCGACCTCTTTTGGTTTTC
                      ____________________________________________________________
consensus AGATTATCGTTCAGCGATGACATCGCAGCTTGTAAGTAATCTCGACCTCTTTTGGTTTTC
 
. : . : . : . : . : . :
JMFS109G09+ TTCGTGCTTCTTTCCAATAGATCTTGATCTTCCGGCGACCGATGAGTCACCGACGGCGTG
JMSF041N21+ TTCGTGNTTCTTTCCAATAGATCTTGATNTTCCGGCGACCGATGAGTCACCGACGGCGTG
                      ____________________________________________________________
consensus TTCGTGCTTCTTTCCAATAGATCTTGATCTTCCGGCGACCGATGAGTCACCGACGGCGTG
 
. : . : . : . : . : . :
JMFS109G09+ AAGTTCTCAGAGGGAGAGTCCG
JMSF041N21+ AAGTTCTCAGAGGGAGAGTCCGCTCGTGTAGCCATATAATGGATGATAAAATTTTCAACG
                      ____________________________________________________________
consensus AAGTTCTCAGAGGGAGAGTCCGCTCGTGTAGCCATATAATGGATGATAAAATTTTCAACG