Previous Contig 007449:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS005C04Sequence554007449 (3)gb:AP006062_18607352e-28Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P041
JMSF041N14Sequence788007449 (3)gb:AP006062_18607355e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P041637023958gb:AY057505_15639242e-33Arabidopsis thaliana AT5g35440/MOK9_2 mRNA, complete cds.>gb:AY103308_1578136 Ar
JMSF049A17Sequence696007449 (3)gb:AP006062_18607354e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P041715024340gb:AY056133_15634686e-89Arabidopsis thaliana unknown protein (At3g18660) mRNA, complete cds.>gb:AY142690

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS005C04+ TGAAATAATGCATCCAAAGTTGAGAATGCTTTTGCATA
                      ____________________________________________________________
consensus TGAAATAATGCATCCAAAGTTGAGAATGCTTTTGCATA
 
. : . : . : . : . : . :
JMFS005C04+ TTCATGCAGATGGAACCAAGAAACTGCTAGGTTGTACACTGTCATTGAAGTATCAAATTC
                      ____________________________________________________________
consensus TTCATGCAGATGGAACCAAGAAACTGCTAGGTTGTACACTGTCATTGAAGTATCAAATTC
 
. : . : . : . : . : . :
JMFS005C04+ ATCAATCAATACTGGGGAACTATGTAGGGTAGAATACTGGTTTGACATGATATTATTTCC
JMSF049A17+ GGGTAGAATACTGGTTTGACATGATATTATTTCC
                      ____________________________________________________________
consensus ATCAATCAATACTGGGGAACTATGTAGGGTAGAATACTGGTTTGACATGATATTATTTCC
 
. : . : . : . : . : . :
JMFS005C04+ TTTAACGCCAGCTGCAGATTTTCTTCCAACATTACCAGTGGCCTCTGAATGATCTCCATC
JMSF049A17+ TTTAACGCCAGCTGCAGATTTTCTTCCAACATTACCAGTGGCCTCTGAATGATCTCCATC
JMSF041N14+ TCTCCATC
                      ____________________________________________________________
consensus TTTAACGCCAGCTGCAGATTTTCTTCCAACATTACCAGTGGCCTCTGAATGATCTCCATC
 
. : . : . : . : . : . :
JMFS005C04+ AGCACCAGCATGATCGTTGCAGAACCTCTTAACCTCATTGAGTTCTTCTATAAGGCTCTT
JMSF049A17+ AGCACCAGCATGATCGTTGCAGAACCTCTTAACCTCATTGAGTTCTTCTATAAGGCTCTT
JMSF041N14+ AGCACCAGCATGATCGTTGCAGAACCTCTTAACCTCATTGAGTTCTTCTATAAGGCTCTT
                      ____________________________________________________________
consensus AGCACCAGCATGATCGTTGCAGAACCTCTTAACCTCATTGAGTTCTTCTATAAGGCTCTT
 
. : . : . : . : . : . :
JMFS005C04+ AGGATCTGAATGCTCATCTTGAAAGCTCTTTGCAATTGCAATGTTATGAAGAACTTTTGG
JMSF049A17+ AGGATCTGAATGCTCATCTTGAAAGCTCTTTGCAATTGCAATGTTATGAAGAACTTTTGG
JMSF041N14+ AGGATCTGAATGCTCATCTTGAAAGCTCTTTGCAATTGCAATGTTATGAAGAACTTTTGG
                      ____________________________________________________________
consensus AGGATCTGAATGCTCATCTTGAAAGCTCTTTGCAATTGCAATGTTATGAAGAACTTTTGG
 
. : . : . : . : . : . :
JMFS005C04+ ATCGCCTGCTTTTTTCTGCTGCAGCTGAAGCAAAACTCTAATACAGTCCAAGAATTTCCC
JMSF049A17+ ATCGCCTGCTTTTTTCTGCTGCAGCTGAAGCAAAACTCTAATACAGTCCAAGAATTTCCC
JMSF041N14+ ATCGCCTGCTTTTTTCTGCTGCAGCTGAAGCAAAACTCTAATACAGTCCAAGAATTTCCC
                      ____________________________________________________________
consensus ATCGCCTGCTTTTTTCTGCTGCAGCTGAAGCAAAACTCTAATACAGTCCAAGAATTTCCC
 
. : . : . : . : . : . :
JMFS005C04+ CGATTGGAAAAGCAGAGCGGCCTCCTTAGCAAGTCCAGAAATGACGGAGAGGGCGCCCTC
JMSF049A17+ CGATTGGAAAAGCAGAGCGGCCTCCTTAGCAAGTCCAGAAATGACGGAGAGGGCGCCCTC
JMSF041N14+ CGATTGGAAAAGCAGAGCGGCCTCCTTAGCAAGTCCAGAAATGACGGAGAGGGCGCCCTC
                      ____________________________________________________________
consensus CGATTGGAAAAGCAGAGCGGCCTCCTTAGCAAGTCCAGAAATGACGGAGAGGGCGCCCTC
 
. : . : . : . : . : . :
JMFS005C04+ ATCGTTCGCCACTGCAGCCGATGAAGAACCTTCTCGATTATTCGATGTGGCTATCGATGA
JMSF049A17+ ATCGTTCGCCACTGCAGCCGATGAAGAACCTTCTCGATTATTCGATGTGGCTATCGATGA
JMSF041N14+ ATCGTTCGCCACTGCAGCCGATGAAGAACCTTCTCGATTATTCGATGTGGCTATCGATGA
                      ____________________________________________________________
consensus ATCGTTCGCCACTGCAGCCGATGAAGAACCTTCTCGATTATTCGATGTGGCTATCGATGA
 
. : . : . : . : . : . :
JMFS005C04+ TGAATAAGTTGGCGAATCCATTCAGCAACAGATCGA
JMSF049A17+ TGAATAAGTTGGCGAATCCATTCAGCAACAGATCGAATCAACAACCGCTTTGAAATACAC
JMSF041N14+ TGAATAAGTTGGCGAATCCATTCAGCAACAGATCGAATCAACAACCGCTTTGAAATACAC
                      ____________________________________________________________
consensus TGAATAAGTTGGCGAATCCATTCAGCAACAGATCGAATCAACAACCGCTTTGAAATACAC
 
. : . : . : . : . : . :
JMSF049A17+ CGTAACGATCCCAAAAATCCTTAGCTTATCAGCTTAGAGCTTCACTAGCAGACTATGTTA
JMSF041N14+ CGTAACGATCCCAAAAATCCTTAGCTTATCAGCTTAGAGCTTCACTAGCAGACTATGTTA
                      ____________________________________________________________
consensus CGTAACGATCCCAAAAATCCTTAGCTTATCAGCTTAGAGCTTCACTAGCAGACTATGTTA
 
. : . : . : . : . : . :
JMSF049A17+ ATCTTCTCTACATTCAAATCCGAATTCAGATAAGTAGACTGAAAGATGCTCAAAACCCTA
JMSF041N14+ ATCTTCTCTACATTCAAATCCGAATTCAGATAAGTAGACTGAAAGATGCTCAAAACCCTA
                      ____________________________________________________________
consensus ATCTTCTCTACATTCAAATCCGAATTCAGATAAGTAGACTGAAAGATGCTCAAAACCCTA
 
. : . : . : . : . : . :
JMSF049A17+ CAGCTTCAACAATAAGAGTTTCATGTATATTTCAGGTTGTATACATGTATACATCTGTAT
JMSF041N14+ CAGCTTCAACAATAAGAGTTTCATGTATATTTCAGGTTGTATACATGTATACATCTGTAT
                      ____________________________________________________________
consensus CAGCTTCAACAATAAGAGTTTCATGTATATTTCAGGTTGTATACATGTATACATCTGTAT
 
. : . : . : . : . : . :
JMSF049A17+ GTATCGATTAGCATACGTCGATTACTCGATTTCAGCATGAGAGAGAGGGGGGATCACTGC
JMSF041N14+ GTATCGATTAGCATACGTCGATTACTCGATTTCAGCATGAGAGAGAGGGGGGATCACTGC
                      ____________________________________________________________
consensus GTATCGATTAGCATACGTCGATTACTCGATTTCAGCATGAGAGAGAGGGGGGATCACTGC
 
. : . : . : . : . : . :
JMSF049A17+ TC
JMSF041N14+ TCACTGGTATTGGGGGACTGATCATATCAGAATTACAGAAAAGAGAATGAATAGGGGGAA
                      ____________________________________________________________
consensus TCACTGGTATTGGGGGACTGATCATATCAGAATTACAGAAAAGAGAATGAATAGGGGGAA
 
. : . : . : . : . : . :
JMSF041N14+ GGGGGGAAAAGAAATCAGGAAATTGGGAGTTTCTTTCGTTAAGTGGCTAATTTTTTATTA
                      ____________________________________________________________
consensus GGGGGGAAAAGAAATCAGGAAATTGGGAGTTTCTTTCGTTAAGTGGCTAATTTTTTATTA
 
. : . : . : . : . : . :
JMSF041N14+ AAATAAAAATCAAATAAGTTATCGAACTACACACGAAATTGTAATTGGACCTTTGAACCC
                      ____________________________________________________________
consensus AAATAAAAATCAAATAAGTTATCGAACTACACACGAAATTGTAATTGGACCTTTGAACCC