Previous Contig 007448:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS092C10Sequence625007448 (2)gb:AB022216_15150512e-49Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGD8.
JMSF041N08Sequence714007448 (2)gb:AB022216_15150511e-47Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGD8.631023957gb:AB022216_15150502e-14Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGD8.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041N08+ CTGCTTCGACATTATCTTGGACATGTAGCACATTATCCACAAAGTGATGGAACA
                      ____________________________________________________________
consensus CTGCTTCGACATTATCTTGGACATGTAGCACATTATCCACAAAGTGATGGAACA
 
. : . : . : . : . : . :
JMFS092C10+ TGCAAGCAAGGGTACAAGTATCTCCTTTGCAATAAGCTCTAGCTGAGGAGGAACTGGCT
JMSF041N08+ CTGCAAGCAAGGGTACAAGTATCTCCTTTGCAATAAGCTCTAGCTGAGGAGGAACTGGCT
                      ____________________________________________________________
consensus CTGCAAGCAAGGGTACAAGTATCTCCTTTGCAATAAGCTCTAGCTGAGGAGGAACTGGCT
 
. : . : . : . : . : . :
JMFS092C10+ CCTTTGCAAGTGTTGGATTCAAGAAGTACTTGAAAGGTCTAATCAGGGATTGAAGAACAG
JMSF041N08+ CCTTTGCAAGTGTTGGATTCAAGAAGTACTTGAAAGGTCTAATCAGGGATTGAAGAACAG
                      ____________________________________________________________
consensus CCTTTGCAAGTGTTGGATTCAAGAAGTACTTGAAAGGTCTAATCAGGGATTGAAGAACAG
 
. : . : . : . : . : . :
JMFS092C10+ TGAGTGAGTTGATAGTTTTCCATTCAGAACTGCCCTTGTTACTAATCATATTGCTGTTTT
JMSF041N08+ TGAGTGAGTTGATAGTTTTCCATTCAGAACTGCCCTTGTTACTAATCATATTGCTGTTTT
                      ____________________________________________________________
consensus TGAGTGAGTTGATAGTTTTCCATTCAGAACTGCCCTTGTTACTAATCATATTGCTGTTTT
 
. : . : . : . : . : . :
JMFS092C10+ GAATAACAGATCTCAGTTCTGGTACAATTTCAGGCCAGGAACTACTCTTCACAAACTCGA
JMSF041N08+ GAATAACAGATCTCAGTTCTGGTACAATTTCAGGCCAGGAACTACTCTTCACAAACTCGA
                      ____________________________________________________________
consensus GAATAACAGATCTCAGTTCTGGTACAATTTCAGGCCAGGAACTACTCTTCACAAACTCGA
 
. : . : . : . : . : . :
JMFS092C10+ CAGCAACAATTGAGCGGAATGCTTCGTTTAAAACTCTGAGAATTGCTGGTTCAGTTTGAA
JMSF041N08+ CAGCAACAATTGAGCGGAATGCTTCGTTTAAAACTCTGAGAATTGCTGGTTCAGTTTGAA
                      ____________________________________________________________
consensus CAGCAACAATTGAGCGGAATGCTTCGTTTAAAACTCTGAGAATTGCTGGTTCAGTTTGAA
 
. : . : . : . : . : . :
JMFS092C10+ GC-AAAACGTGCACTAAAGCATCTCTGAACTCCTTGCTGAGTTTCTGATTTGCATCATTA
JMSF041N08+ GCAAAAACGTGCACTAAAGCATCTCTGAACTCCTTGCTGAGTTTCTGATTTGCATCATTA
                      ____________________________________________________________
consensus GCAAAAACGTGCACTAAAGCATCTCTGAACTCCTTGCTGAGTTTCTGATTTGCATCATTA
 
. : . : . : . : . : . :
JMFS092C10+ GCATCAATATTTCTCCTGATGAAGTTCTTAAGATAGGTAGCAGCAGCTATCTTTTGACCT
JMSF041N08+ GCATCAATATTTCTCCTGATGAAGTTCTTAAGATAGGTAGCAGCAGCTATCTTTTGACCT
                      ____________________________________________________________
consensus GCATCAATATTTCTCCTGATGAAGTTCTTAAGATAGGTAGCAGCAGCTATCTTTTGACCT
 
. : . : . : . : . : . :
JMFS092C10+ TCATTTTCACCTCCCGTGGCAATAGAGAGGAGATAGAATGGAAAATCTGGAAGCATAGAG
JMSF041N08+ TCATTTTCACCTCCCGTGGCAATAGAGAGGAGATAGAATGGAAAATCTGGAAGCATAGAG
                      ____________________________________________________________
consensus TCATTTTCACCTCCCGTGGCAATAGAGAGGAGATAGAATGGAAAATCTGGAAGCATAGAG
 
. : . : . : . : . : . :
JMFS092C10+ AGGCGATCGAGAGCATCGGTGGCTAAGTTGACAACGTTGCCATCAGAGCTTAAAGTTTGA
JMSF041N08+ AGGCGATCGAGAGCATCGGTGGCTAAGTTGACAACGTTGCCATCAGAGCTTAAAGTTTGA
                      ____________________________________________________________
consensus AGGCGATCGAGAGCATCGGTGGCTAAGTTGACAACGTTGCCATCAGAGCTTAAAGTTTGA
 
. : . : . : . : . : . :
JMFS092C10+ TTGAGAAGCTGAGCGATTTGGTGGTTTTCCATAGCTAGGCCCGGCGAGACGCAGCAGAAC
JMSF041N08+ TTGAGAAGCTGAGCGATTTGGTGGTTTTCCATAGCTAGGCCCGGCGAGACGCAGCAGAAC
                      ____________________________________________________________
consensus TTGAGAAGCTGAGCGATTTGGTGGTTTTCCATAGCTAGGCCCGGCGAGACGCAGCAGAAC
 
. : . : . : . : . : . :
JMFS092C10+ CCTAGCTAACGCTGTCAGCTGGAAAGA
JMSF041N08+ CCTAGCTAACGCTGTCAGCTGGAAAGAGGCAATGGGCAAAAGAAAGTTGTGGGAGTTACC
                      ____________________________________________________________
consensus CCTAGCTAACGCTGTCAGCTGGAAAGAGGCAATGGGCAAAAGAAAGTTGTGGGAGTTACC