Previous Contig 007447:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032L06Sequence568007447 (4)gb:AP002071_18219551e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P067741013375 (4)gb:AP005260_18497635e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P055
JMSF008L09Sequence480007447 (4)gb:AP002071_18219553e-60Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P067755012361 (3)gb:AP005260_18497639e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P055
JMSF025B20Sequence617007447 (4)gb:AP002071_18219553e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P067784013375 (4)gb:AP005260_18497636e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P055
JMSF041N04Sequence780007447 (4)gb:AY054519_15631733e-93Arabidopsis thaliana Unknown protein (At1g07360; F22G5.30) mRNA, complete cds.>g609013375 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041N04+ TCTTGTACATTGACCCCGAACATAAAAACTGCAAACATGAGCTCGATTTCTCTTGTAGTA
                      ____________________________________________________________
consensus TCTTGTACATTGACCCCGAACATAAAAACTGCAAACATGAGCTCGATTTCTCTTGTAGTA
 
. : . : . : . : . : . :
JMSF041N04+ TGGGGTAGTTCGTTGAAGCTTCAAAATAGTATCATTTGGACGGACCTTCCCATACGAAGA
                      ____________________________________________________________
consensus TGGGGTAGTTCGTTGAAGCTTCAAAATAGTATCATTTGGACGGACCTTCCCATACGAAGA
 
. : . : . : . : . : . :
JMSF025B20+ CTGCGGTCATGCTCCTCAGCAAAGTATTCTCTATT
JMSF041N04+ TTCATAATCTATCCCGGCTCTGGCCCTGCGGTCATGCTCCTCAGCAAAGTATTCTCTATT
                      ____________________________________________________________
consensus TTCATAATCTATCCCGGCTCTGGCCCTGCGGTCATGCTCCTCAGCAAAGTATTCTCTATT
 
. : . : . : . : . : . :
JMFF032L06+ ACATCACTCTTTGGAATGGCATCATTGGAATTGATACTAAGCGCAGTGTCTCGAACCTG
JMSF008L09+ ACATCACTCTTCGGAATGGCATCATNGGAATTGATACTAAGAGCGGTGTCTCGGACCTG
JMSF025B20+ CACATCACTCTTTGGAATGGCATCATTGGAATTGATACTAAGCGCAGTGTCTCGAACCTG
JMSF041N04+ CACATCACTCTTTGGAATGGCATCATTGGAATTGATACTAAGCGCAGTGTCTCGAACCTG
                      ____________________________________________________________
consensus CACATCACTCTTTGGAATGGCATCATTGGAATTGATACTAAGCGCAGTGTCTCGAACCTG
 
. : . : . : . : . : . :
JMFF032L06+ AACTGGCAATCCATATTCAAGATCCAGAAGACAAACTTGGCAAACATTCTTCAACTTGCT
JMSF008L09+ AACAGGTAACCCATATTCAAGATCAAGAAGACAAACTTGACAAACGTTCTTCAACTTGCA
JMSF025B20+ AACTGGCAATCCATATTCAAGATCCAGAAGACAAACTTGGCAAACATTCTTCAACTTGCT
JMSF041N04+ AACTGGCAATCCATATTCAAGATCCAGAAGACAAACTTGGCAAACATTCTTCAACTTGCT
                      ____________________________________________________________
consensus AACTGGCAATCCATATTCAAGATCCAGAAGACAAACTTGGCAAACATTCTTCAACTTGCT
 
. : . : . : . : . : . :
JMFF032L06+ GCAGGTTTGACATATCTCAGATTTCTTGTATCTAGCATCTCGACCTGGCCTCCACCTAAA
JMSF008L09+ GCACGTCTGACAGATCTCAGTTTTCTTGTACCTCGCATCCCGACCAGGCCTCCACCTGAA
JMSF025B20+ GCAGGTTTGACATATCTCAGATTTCTTGTATCTAGCATCTCGACCTGGCCTCCACCTAAA
JMSF041N04+ GCAGGTTTGACATATCTCAGATTTCTTGTATCTAGCATCTCGACCTGGCCTCCACCTAAA
                      ____________________________________________________________
consensus GCAGGTTTGACATATCTCAGATTTCTTGTATCTAGCATCTCGACCTGGCCTCCACCTAAA
 
. : . : . : . : . : . :
JMFF032L06+ AACAGTGAAGGGTCGGGTGCAAATCTTGCATTCCTTGTCATAATCAGCTTTAGTCATTCG
JMSF008L09+ AACAGTGAAGGGTCTTGTACAAATCTTGCATTCCTTGTCATAATCAGCTTTACTCATCCG
JMSF025B20+ AACAGTGAAGGGTCGGGTGCAAATCTTGCATTCCTTGTCATAATCAGCTTTAGTCATTCG
JMSF041N04+ AACAGTGAAGGGTCGGGTGCAAATCTTGCATTCCTTGTCATAATCAGCTTTAGTCATTCG
                      ____________________________________________________________
consensus AACAGTGAAGGGTCGGGTGCAAATCTTGCATTCCTTGTCATAATCAGCTTTAGTCATTCG
 
. : . : . : . : . : . :
JMFF032L06+ AACGTATGGACTGTCACCAAGACACGACTCACATATAATCGGAAAGTCAGATCGCTCCCA
JMSF008L09+ AACGTAAGGACTGTCGCCGAGACACGACTCGCAGATGATCGGAAAGTCCGACCGTTCCCA
JMSF025B20+ AACGTATGGACTGTCACCAAGACACGACTCACATATAATCGGAAAGTCAGATCGCTCCCA
JMSF041N04+ AACGTATGGACTGTCACCAAGACACGACTCACATATAATCGGAAAGTCAGATCGCTCCCA
                      ____________________________________________________________
consensus AACGTATGGACTGTCACCAAGACACGACTCACATATAATCGGAAAGTCAGATCGCTCCCA
 
. : . : . : . : . : . :
JMFF032L06+ TCCATCAGCTTCAACATCTCTCAATAGCCTATGAGCCATGAACCCGTTGTAACTTTAATC
JMSF008L09+ TCCATCAGCTTCGGCGTCTCTCAATAGCCTATGCGCCAT
JMSF025B20+ TCCATCAGCTTCAACATCTCTCAATAGCCTATGAGCCATGAACCCGTTGTAACTTTAATC
JMSF041N04+ TCCATCAGCTTCAACATCTCTCAATAGCCTATGAGCCATGAACCCGTTGTAACTTTAATC
                      ____________________________________________________________
consensus TCCATCAGCTTCAACATCTCTCAATAGCCTATGAGCCATGAACCCGTTGTAACTTTAATC
 
. : . : . : . : . : . :
JMFF032L06+ CCACACCTGGAGTTAATTTAAACACGAAGATGCGCTATTTCCCCGTGATTACGCACGAAC
JMSF025B20+ CCACACCTGGAGTTAATTTAAACACGAAGATGCGCTATTTCCCCGTGATTACGCACGAAC
JMSF041N04+ CCACACCTGGAGTTAATTTAAACACGAAGATGCGCTATTTCCCCGTGATTACGCACGAAC
                      ____________________________________________________________
consensus CCACACCTGGAGTTAATTTAAACACGAAGATGCGCTATTTCCCCGTGATTACGCACGAAC
 
. : . : . : . : . : . :
JMFF032L06+ AGTGTGATTCGCTGCTTGCTAATGTTAATCGGAGATGCCGTAGATTGTACGGATCGACGG
JMSF025B20+ AGTGTGATTCGCTGCTTGCTAATGTTAATCGGAGATGCCGTAGATTGTACGGATCGACGG
JMSF041N04+ AGTGTGATTCGCTGCTTGCTAATGTTAATCGGAGATGCCGTAGATTGTACGGATCGACGG
                      ____________________________________________________________
consensus AGTGTGATTCGCTGCTTGCTAATGTTAATCGGAGATGCCGTAGATTGTACGGATCGACGG
 
. : . : . : . : . : . :
JMFF032L06+ CGAACGCTTTTCGGCCGGCGGAGCGAGAGGGAAAAGAGGATGAGCAAATCGTTGAAATGC
JMSF025B20+ CGAACGCTTTTCGGCCGGCGGAGCGAGAGGGAAAAGAGGATGAGCAAATCGTTGAAATGC
JMSF041N04+ CGAACGCTTTTCGGCCGGCGGAGCGAGAGGGAAAAGAGGATGAGCAAATCGTTGAAATGC
                      ____________________________________________________________
consensus CGAACGCTTTTCGGCCGGCGGAGCGAGAGGGAAAAGAGGATGAGCAAATCGTTGAAATGC
 
. : . : . : . : . : . :
JMFF032L06+ AGTGAGAGAACGAGCCTTCTTT
JMSF025B20+ AGTGAGAGAACGAGCCTTCTTTGCCAATGAGGATTTTTTTC
JMSF041N04+ AGTGAGAGAACGAGCCTTCTTTGCCAATGAGGATTTTTTTCGGATTAAAATAAATTTCTT
                      ____________________________________________________________
consensus AGTGAGAGAACGAGCCTTCTTTGCCAATGAGGATTTTTTTCGGATTAAAATAAATTTCTT