Previous Contig 007443:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS025B10Sequence616007443 (10)gb:AP003683_18319603e-66Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P043
JMFS081B10Sequence623007443 (10)gb:AY091780_15747395e-56Arabidopsis thaliana At3g54435 mRNA, complete cds.
JMFS081C01Sequence625007443 (10)gb:AY091780_15747394e-53Arabidopsis thaliana At3g54435 mRNA, complete cds.
JMFS081G03Sequence624007443 (10)gb:AY091780_15747394e-53Arabidopsis thaliana At3g54435 mRNA, complete cds.
JMFS096D05Sequence621007443 (10)gb:AY091780_15747395e-53Arabidopsis thaliana At3g54435 mRNA, complete cds.
JMFS111B06Sequence624007443 (10)gb:AY091780_15747396e-54Arabidopsis thaliana At3g54435 mRNA, complete cds.
JMFS117C04Sequence624007443 (10)gb:AY091780_15747395e-59Arabidopsis thaliana At3g54435 mRNA, complete cds.
JMFS128F05Sequence612007443 (10)gb:AP003683_18319605e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P043
JMSF025L18Sequence669007443 (10)gb:AY091780_15747391e-55Arabidopsis thaliana At3g54435 mRNA, complete cds.739004021 (3)gb:AY091780_15747392e-86Arabidopsis thaliana At3g54435 mRNA, complete cds.
JMSF041M12Sequence786007443 (10)gb:AY091780_15747391e-65Arabidopsis thaliana At3g54435 mRNA, complete cds.630004021 (3)gb:AY091780_15747393e-76Arabidopsis thaliana At3g54435 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS025B10+ TGCCCATTAACAAGCAGCTCTTTTGGTGCTTTAGA
                      ____________________________________________________________
consensus TGCCCATTAACAAGCAGCTCTTTTGGTGCTTTAGA
 
. : . : . : . : . : . :
JMFS025B10+ TATTTGCCGTATGCCAACTTGACATGATTCACAATCAATGATATGTCCTGAAGCATCTTT
                      ____________________________________________________________
consensus TATTTGCCGTATGCCAACTTGACATGATTCACAATCAATGATATGTCCTGAAGCATCTTT
 
. : . : . : . : . : . :
JMFS025B10+ AATGGTGATAACAAGAGTATAAAGGTTGGGCTGCTCTGCAGACCAGAGCTTTGGCGCTTG
JMFS128F05+ AGCTTTGGCGCTTG
                      ____________________________________________________________
consensus AATGGTGATAACAAGAGTATAAAGGTTGGGCTGCTCTGCAGACCAGAGCTTTGGCGCTTG
 
. : . : . : . : . : . :
JMFS025B10+ CACTTTCCCCACAAGAGAATACCCTTTAAATCCTAAATAGTAATCACTTTTGGAAGTAAA
JMFS128F05+ CACTTTCCCCACAAGAGAATACCCTTTAAATCCTAAATAGTAATCACTTTTGGAAGTAAA
                      ____________________________________________________________
consensus CACTTTCCCCACAAGAGAATACCCTTTAAATCCTAAATAGTAATCACTTTTGGAAGTAAA
 
. : . : . : . : . : . :
JMFS025B10+ TTGTAAAGGAGTTGCATCTGCAGAAAGCAGATCACTGTCTTTCGCTTTATCGCACAAACT
JMFS128F05+ TTGTAAAGGAGTTGCATCTGCAGAAAGCAGATCACTGTCTTTCGCTTTATCGCACAAACT
                      ____________________________________________________________
consensus TTGTAAAGGAGTTGCATCTGCAGAAAGCAGATCACTGTCTTTCGCTTTATCGCACAAACT
 
. : . : . : . : . : . :
JMFS025B10+ TCCATTTTCATATATTGCAGCTTCAACAGTGAAGTCAGAAAGACTTAGATCGGCATATGA
JMFS128F05+ TCCATTTTCATATATTGCAGCTTCAACAGTGAAGTCAGAAAGACTTAGATCGGCATATGA
                      ____________________________________________________________
consensus TCCATTTTCATATATTGCAGCTTCAACAGTGAAGTCAGAAAGACTTAGATCGGCATATGA
 
. : . : . : . : . : . :
JMFS025B10+ GTTATCAATTTCCACTTCAACCTCTATATCTGCATAAGAAAAATCTTCTGTCAAGTTTGA
JMFS128F05+ GTTATCAATTTCCACTTCAACCTCTATATCTGCATAAGAAAAATCTTCTGTCAAGTTTGA
                      ____________________________________________________________
consensus GTTATCAATTTCCACTTCAACCTCTATATCTGCATAAGAAAAATCTTCTGTCAAGTTTGA
 
. : . : . : . : . : . :
JMFS025B10+ CTTAAAAAAATAGTCAGCAATAAATATCTTTGGCTTTGAAATAAGATGCACATCACGATG
JMFS128F05+ CTTAAAAAAATAGTCAGCAATAAATATCTTTGGCTTTGAAATAAGATGCACATCACGATG
                      ____________________________________________________________
consensus CTTAAAAAAATAGTCAGCAATAAATATCTTTGGCTTTGAAATAAGATGCACATCACGATG
 
. : . : . : . : . : . :
JMFS025B10+ AATGCCAGACAACCACCAGTGATCTTGATCTTCAAGGTAAGACCCATCACTCCATCGCAT
JMFS128F05+ AATGCCAGACAACCACCAGTGATCTTGATCTTCAAGGTAAGACCCATCACTCCATCGCAT
                      ____________________________________________________________
consensus AATGCCAGACAACCACCAGTGATCTTGATCTTCAAGGTAAGACCCATCACTCCATCGCAT
 
. : . : . : . : . : . :
JMFS025B10+ TACTTGAACAGCTAGACAATTGCAGTTATCAGACCCACAGGGTTTACAAAAACTGGTTAT
JMFS128F05+ TACTTGAACAGCTAGACAATTGCAGTTATCAGACCCACAGGGTTTACAAAAACTGGTTAT
                      ____________________________________________________________
consensus TACTTGAACAGCTAGACAATTGCAGTTATCAGACCCACAGGGTTTACAAAAACTGGTTAT
 
. : . : . : . : . : . :
JMFS025B10+ CTCAAATTCCGCAGGTAATCTACTGTCCTGGCTATATCCAA
JMFS128F05+ CTCAAATTCCGCAGGTAATCTACTGTCCTGGCTATATCCAACAGGAACCCCATTTACCCA
                      ____________________________________________________________
consensus CTCAAATTCCGCAGGTAATCTACTGTCCTGGCTATATCCAACAGGAACCCCATTTACCCA
 
. : . : . : . : . : . :
JMFS128F05+ GGTATAGAACGCGGAATCCACAGCTTCAAAATGTAGAAATATCCTGCGTCCTTCCCATTC
JMSF041M12+ CCATTC
                      ____________________________________________________________
consensus GGTATAGAACGCGGAATCCACAGCTTCAAAATGTAGAAATATCCTGCGTCCTTCCCATTC
 
. : . : . : . : . : . :
JMFS128F05+ TTTAGGAAGGAAAAACAAAGTCCTGTAACAGCCAGTGGGATTCTCATCAGGAACTTTG
JMFS111B06+ G
JMSF025L18+ CAGGAACTTTGGG
JMFS081B10+ CAGGAACTTTGGG
JMFS117C04+ AGCCAGTGGGATTCTCATCAGGAACTTTGGG
JMSF041M12+ TTTAGGAAGGAAAAACAAAGTCCTGTAACAGCCAGTGGGATTCTCATCAGGAACTTTGGG
                      ____________________________________________________________
consensus TTTAGGAAGGAAAAACAAAGTCCTGTAACAGCCAGTGGGATTCTCATCAGGAACTTTGGG
 
. : . : . : . : . : . :
JMFS081G03+ GATCAAAATGAAAGGGATATTTAACATTAGTATAAATTGGTGTGTCATGTCCATGACA
JMFS081C01+ GATCAAAATGAAAGGGATATTTAACATTAGTATAAATTGGTGTGTCATGTCCATGACA
JMFS111B06+ CGGATCAAAATGAAAGGGATATTTAACATTAGTATAAATTGGTGTGTCATGTCCATGACA
JMSF025L18+ CGGATCAAAATGAAAGGGATATTTAACATTAGTATAAATTGGTGTGTCATGTCCATGACA
JMFS096D05+ AAATGAAAGGGATATTTAACATTAGTATAAATTGGTGTGTCATGTCCATGACA
JMFS081B10+ CGGATCAAAATGAAAGGGATATTTAACATTAGTATAAATTGGTGTGTCATGTCCATGACA
JMFS117C04+ CGGATCAAAATGAAAGGGATATTTAACATTAGTATAAATTGGTGTGTCATGTCCATGACA
JMSF041M12+ CGGATCAAAATGAAAGGGATATTTAACATTAGTATAAATTGGTGTGTCATGTCCATGACA
                      ____________________________________________________________
consensus CGGATCAAAATGAAAGGGATATTTAACATTAGTATAAATTGGTGTGTCATGTCCATGACA
 
. : . : . : . : . : . :
JMFS081G03+ CTGCCAATTGGAAGGAACTGGAATTTTGGTCCAAGTAGAGTCCTGAAAAGAGGTATCATA
JMFS081C01+ CTGCCAATTGGAAGGAACTGGAATTTTGGTCCAAGTAGAGTCCTGAAAAGAGGTATCATA
JMFS111B06+ CTGCCAATTGGAAGGAACTGGAATTTTGGTCCAAGTAGAGTCCTGAAAAGAGGTATCATA
JMSF025L18+ CTGCCAATTGGAAGGAACTGGAATTTTGGTCCAAGTAGAGTCCTGAAAAGAGGTATCATA
JMFS096D05+ CTGCCAATTGGAAGGAACTGGAATTTTGGTCCAAGTAGAGTCCTGAAAAGAGGTATCATA
JMFS081B10+ CTGCCAATTGGAAGGAACTGGAATTTTGGTCCAAGTAGAGTCCTGAAAAGAGGTATCATA
JMFS117C04+ CTGCCAATTGGAAGGAACTGGAATTTTGGTCCAAGTAGAGTCCTGAAAAGAGGTATCATA
JMSF041M12+ CTGCCAATTGGAAGGAACTGGAATTTTGGTCCAAGTAGAGTCCTGAAAAGAGGTATCATA
                      ____________________________________________________________
consensus CTGCCAATTGGAAGGAACTGGAATTTTGGTCCAAGTAGAGTCCTGAAAAGAGGTATCATA
 
. : . : . : . : . : . :
JMFS081G03+ AAAATTTGAAGGAACAGCGGGAGGACTAGGAGCCAGGAAGAAATTCCAATAGCCTGACAA
JMFS081C01+ AAAATTTGAAGGAACAGCGGGAGGACTAGGAGCCAGGAAGAAATTCCAATAGCCTGACAA
JMFS111B06+ AAAATTTGAAGGAACAGCGGGAGGACTAGGAGCCAGGAAGAAATTCCAATAGCCTGACAA
JMSF025L18+ AAAATTTGAAGGAACAGCGGGAGGACTAGGAGCCAGGAAGAAATTCCAATAGCCTGACAA
JMFS096D05+ AAAATTTGAAGGAACAGCGGGAGGACTAGGAGCCAGGAAGAAATTCCAATAGCCTGACAA
JMFS081B10+ AAAATTTGAAGGAACAGCGGGAGGACTAGGAGCCAGGAAGAAATTCCAATAGCCTGACAA
JMFS117C04+ AAAATTTGAAGGAACAGCGGGAGGACTAGGAGCCAGGAAGAAATTCCAATAGCCTGACAA
JMSF041M12+ AAAATTTGAAGGAACAGCGGGAGGACTAGGAGCCAGGAAGAAATTCCAATAGCCTGACAA
                      ____________________________________________________________
consensus AAAATTTGAAGGAACAGCGGGAGGACTAGGAGCCAGGAAGAAATTCCAATAGCCTGACAA
 
. : . : . : . : . : . :
JMFS081G03+ AGACTTGACAAAAGGCAAACCTTCCACCCACCGAGCAGCACAATCAAGCGCCTCAGGAAC
JMFS081C01+ AGACTTGACAAAAGGCAAACCTTCCACCCACCGAGCAGCACAATCAAGCGCCTCAGGAAC
JMFS111B06+ AGACTTGACAAAAGGCAAACCTTCCACCCACCGAGCAGCACAATCAAGCGCCTCAGGAAC
JMSF025L18+ AGACTTGACAAAAGGCAAACCTTCCACCCACCGAGCAGCACAATCAAGCGCCTCAGGAAC
JMFS096D05+ AGACTTGACAAAAGGCAAACCTTCCACCCACCGAGCAGCACAATCAAGCGCCTCAGGAAC
JMFS081B10+ AGACTTGACAAAAGGCAAACCTTCCACCCACCGAGCAGCACAATCAAGCGCCTCAGGAAC
JMFS117C04+ AGACTTGACAAAAGGCAAACCTTCCACCCACCGAGCAGCACAATCAAGCGCCTCAGGAAC
JMSF041M12+ AGACTTGACAAAAGGCAAACCTTCCACCCACCGAGCAGCACAATCAAGCGCCTCAGGAAC
                      ____________________________________________________________
consensus AGACTTGACAAAAGGCAAACCTTCCACCCACCGAGCAGCACAATCAAGCGCCTCAGGAAC
 
. : . : . : . : . : . :
JMFS081G03+ AGCATCGTCGTCCCAAACTGCAGAATTAGCCACCACAACATCCGCCTTGTTCCGCTCACG
JMFS081C01+ AGCATCGTCGTCCCAAACTGCAGAATTAGCCACCACAACATCCGCCTTGTTCCGCTCACG
JMFS111B06+ AGCATCGTCGTCCCAAACTGCAGAATTAGCCACCACAACATCCGCCTTGTTCCGCTCACG
JMSF025L18+ AGCATCGTCGTCCCAAACTGCAGAATTAGCCACCACAACATCCGCCTTGTTCCGCTCACG
JMFS096D05+ AGCATCGTCGTCCCAAACTGCAGAATTAGCCACCACAACATCCGCCTTGTTCCGCTCACG
JMFS081B10+ AGCATCGTCGTCCCAAACTGCAGAATTAGCCACCACAACATCCGCCTTGTTCCGCTCACG
JMFS117C04+ AGCATCGTCGTCCCAAACTGCAGAATTAGCCACCACAACATCCGCCTTGTTCCGCTTTTG
JMSF041M12+ AGCATCGTCGTCCCAAACTGCAGAATTAGCCACCACAACATCCGCCTTGTTCCGCTCACG
                      ____________________________________________________________
consensus AGCATCGTCGTCCCAAACTGCAGAATTAGCCACCACAACATCCGCCTTGTTCCGCTCACG
 
. : . : . : . : . : . :
JMFS081G03+ CCAATACTTAAGGGATCCTTCCACGGATTCATGGCAACGGAATGGGACATGAGCATCCCG
JMFS081C01+ CCAATACTTAAGGGATCCTTCCACGGATTCATGGCAACGGAATGGGACATGAGCATCCCG
JMFS111B06+ CCAATACTTAAGGGATCCTTCCACGGATTCATGGCAACGGAATGGGACATGAGCATCCCG
JMSF025L18+ CCAATACTTAAGGGATCCTTCCACGGATTCATGGCAACGGAATGGGACATGAGCATCCCG
JMFS096D05+ CCAATACTTAAGGGATCCTTCCACGGATTCATGGCAACGGAATGGGACATGAGCATCCCG
JMFS081B10+ CCAATACTTAAGGGATCCTTCCACGGATTCATGGCAACGGAATGGGACATGAGCATCCCG
JMFS117C04+ CCAATACTTAAGGGATCCTTCCACGGATTCATGGCAACGGAATGGGACATGAGCATCCCG
JMSF041M12+ CCAATACTTAAGGGATCCTTCCACGGATTCATGGCAACGGAATGGGACATGAGCATCCCG
                      ____________________________________________________________
consensus CCAATACTTAAGGGATCCTTCCACGGATTCATGGCAACGGAATGGGACATGAGCATCCCG
 
. : . : . : . : . : . :
JMFS081G03+ CTTTTTCCATCTGAAGAATGAAGGATCTTCCCAAGGCTTGTAAGCGCTGCTATTTGGGGG
JMFS081C01+ CTTTTTCCATCTGAAGAATGAAGGATCTTCCCAAGGCTTGTAAGCGCTGCTATTTGGGGG
JMFS111B06+ CTTTTTCCATCTGAAGAATGAAGGATCTTCCCAAGGCTTGTAAGCGCTGCTATTTGGGGG
JMSF025L18+ CTTTTTCCATCTGAAGAATGAAGGATCTTCCCAAGGCTTGTAAGCGCTGCTATTTGGGGG
JMFS096D05+ CTTTTTCCATCTGAAGAATGAAGGATCTTCCCAAGGCTTGTAAGCGCTGCTATTTGGGGG
JMFS081B10+ CTTTTTCCATCTGAAGAATGAAGGATCTTCCCAAGGCTTGTAAGCGCTGCTATTTGGGGG
JMFS117C04+ CTTTTTCCATCTGAAGAATGAAGGATCTTCCCAAGGCTTGTAAGCGCTGCTATTTGGGGG
JMSF041M12+ CTTTTTCCATCTGAAGAATGAAGGATCTTCCCAAGGCTTGTAAGCGCTGCTATTTGGGGG
                      ____________________________________________________________
consensus CTTTTTCCATCTGAAGAATGAAGGATCTTCCCAAGGCTTGTAAGCGCTGCTATTTGGGGG
 
. : . : . : . : . : . :
JMFS081G03+ AACCACCATTTGACTAATTACAAAAGCCATCCCCTTTCCAGGCAACGAATCAACGAAACA
JMFS081C01+ AACCACCATTTGACTAATTACAAAAGCCATCCCCTTTCCAGGCAACGAATCAACGAAACA
JMFS111B06+ AACCACCATTTGACTAATTACAAAAGCCATCCCCTTTCCAGGCAACGAATCAACGAAACA
JMSF025L18+ AACCACCATTTGACTAATTACAAAAGCCATCCCCTTTCCAGGCAACGAATCAACGAAACA
JMFS096D05+ AACCACCATTTGACTAATTACAAAAGCCATCCCCTTTCCAGGCAACGAATCAACGAAACA
JMFS081B10+ AACCACCATTTGACTAATTACAAAAGCCATCCCCTTTCCAGGCAACGAATCAACGAAACA
JMFS117C04+ AACCACCATTTGACTAATTACAAAAGCCATCCCCTTTCCAGGCAACGAATCAACGAAACA
JMSF041M12+ AACCACCATTTGACTAATTACAAAAGCCATCCCCTTTCCAGGCAACGAATCAACGAAACA
                      ____________________________________________________________
consensus AACCACCATTTGACTAATTACAAAAGCCATCCCCTTTCCAGGCAACGAATCAACGAAACA
 
. : . : . : . : . : . :
JMFS081G03+ AGAAGAGTTGCAATGACACAAACGCGGTGGAGAGAAGAATTTGAATCATCAAAAGGAAGA
JMFS081C01+ AGAAGAGTTGCAATGACACAAACGCGGTGGAGAGAAGAATTTGAATCATCAAAAGGAAGA
JMFS111B06+ AGAAGAGTTGCAATGACACAAACGCGGTGGAGAGAAGAATTTGAATCATCAAAAGGAAGA
JMSF025L18+ AGAAGAGTTGCAATGACACAAACGCGGTGGAGAGAAGAATTTGAATCATCAAAAGGAAGA
JMFS096D05+ AGAAGAGTTGCAATGACACAAACGCGGTGGAGAGAAGAATTTGAATCATCAAAAGGAAGA
JMFS081B10+ AGAAGAGTTGCAATGACACAAACGCGGTGGAGAGAAGAATTTGAATCATCAAAAGGAAGA
JMFS117C04+ AGAAGAGTTGCAATGACACAAACGCGGTGGAGAGAAGAATTTGAATCATCAAAAGGAAGA
JMSF041M12+ AGAAGAGTTGCAATGACACAAACGCGGTGGAGAGAAGAATTTGAATCATCAAAAGGAAGA
                      ____________________________________________________________
consensus AGAAGAGTTGCAATGACACAAACGCGGTGGAGAGAAGAATTTGAATCATCAAAAGGAAGA
 
. : . : . : . : . : . :
JMFS081G03+ AGATTGGCGATGGATTTGATTTTGAAAGGTATAATAATAATAAGTAGAAGAGTGGAGTGA
JMFS081C01+ AGATTGGCGATGGATTTGATTTTGAAAGGTATAATAATAATAAGTAGAAGAGTGGAGTGA
JMFS111B06+ AGATTGGCGATGGATTTGATTTTGAAAGGTATAATAATAATAAGTAGAAGAGTGGAGTGA
JMSF025L18+ AGATTGGCGATGGATTTGATTTTGAAAGGTATAATAATAATAAGTAGAAGAGTGGAGTGA
JMFS096D05+ AGATTGGCGATGGATTTGATTTTGAAAGGTATAATAATAATAAGTAGAAGAGTGGAGTGA
JMFS081B10+ AGATTGGCGATGGATTTGATTTTGAAAGGTATAATAATAATAAGTAGAAGAGTGGAGTGA
JMFS117C04+ AGATTGGCGATGGATTTGATTTTGAAAGGTATAATAATAATAAGTAGAAGAGT
JMSF041M12+ AGATTGGCGATGGATTTGATTTTGAAAGGTATAATAATAATAAGTAGAAGAGTGGAGTGA
                      ____________________________________________________________
consensus AGATTGGCGATGGATTTGATTTTGAAAGGTATAATAATAATAAGTAGAAGAGTGGAGTGA
 
. : . : . : . : . : . :
JMFS081G03+ GTGCTCTGAGCAAGAAAGTGAAAGGG
JMFS081C01+ GTGCTCTGAGCAAGAAAGTGAAAGGGC
JMFS111B06+ GTGCTCTGAGCAAGAAAGTGAAA
JMSF025L18+ GTGCTCTGAGCAAGAAAGTGAAAGGGCAGACACTAGTCACGAATGGGATGAGATC
JMFS096D05+ GTGCTCTGAGCAAGAAAGTGAAAGGGC
JMFS081B10+ GTGCTC
JMSF041M12+ GTGCTCTGAGCAAGAAAGTGAAAGGGCAGACACTAGTCACGAATGGGATGAGATCACTTT
                      ____________________________________________________________
consensus GTGCTCTGAGCAAGAAAGTGAAAGGGCAGACACTAGTCACGAATGGGATGAGATCACTTT
 
. : . : . : . : . : . :
JMSF041M12+ CATTTTCGGCACGTTGGAACTTTTATCCTTTACTTAGTGCACAGTGCACTGCTCCCCCTC
                      ____________________________________________________________
consensus CATTTTCGGCACGTTGGAACTTTTATCCTTTACTTAGTGCACAGTGCACTGCTCCCCCTC