Previous Contig 007439:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009O09Sequence284007439 (9)gb:AF083788_17670186e-04Arabidopsis thaliana clone sps857 unknown mRNA.689010136 (11)gb:AF209910_17773132e-45Prunus dulcis vacuolar sorting receptor protein mRNA, partial cds.
JMFF031N13Sequence506007439 (9)pir|T02604|T026042e-48probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705713010136 (11)gb:AF209910_17773133e-45Prunus dulcis vacuolar sorting receptor protein mRNA, partial cds.
JMFF041H09Sequence653007439 (9)pir|T02604|T026045e-76probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705632010136 (11)pir|T02602|T026022e-23vacuolar sorting receptor protein homolog At2g14740 - Arabidopsis thaliana>gb:AC
JMFF046I17Sequence618007439 (9)pir|T02604|T026045e-55probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705538010136 (11)gb:AF209910_17773136e-11Prunus dulcis vacuolar sorting receptor protein mRNA, partial cds.
JMFF049C19Sequence471007439 (9)pir|F84706|F847063e-34probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC002338402010136 (11)
JMFF049F12Sequence616007439 (9)pir|T02604|T026045e-55probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705380010136 (11)
JMFF050H09Sequence606007439 (9)pir|T02604|T026041e-66probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705490010136 (11)gb:AF209910_17773138e-13Prunus dulcis vacuolar sorting receptor protein mRNA, partial cds.
JMSF036M14Sequence620007439 (9)pir|T02604|T026041e-58probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705765010136 (11)pir|T02602|T026022e-56vacuolar sorting receptor protein homolog At2g14740 - Arabidopsis thaliana>gb:AC
JMSF041L14Sequence739007439 (9)pir|T02604|T026041e-76probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705663010136 (11)pir|T02602|T026023e-63vacuolar sorting receptor protein homolog At2g14740 - Arabidopsis thaliana>gb:AC

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050H09+ GTCCAT
JMFF041H09+ ACTTCATCAGCATGTCACACTTATACCCACACTCGTCATTGCTGTTAGTCCAT
JMSF041L14+ GTCATTGNTGTTAGTCCAT
                      ____________________________________________________________
consensus ACTTCATCAGCATGTCACACTTATACCCACACTCGTCATTGCTGTTAGTCCAT
 
. : . : . : . : . : . :
JMFF050H09+ AGCTCATATTCCACCCTATCATCGGGATGAGGGACAGCTTCTCTCCAATCAAGATTTACA
JMFF041H09+ AGCTCATATTCCACCCTATCATCGGGATGAGGGACAGCTTCTCTCCAATCAAGATTTACA
JMSF041L14+ AGCTCATATTCCACCCTATCATCGGGATGAGGGACAGNTTCTCTCCAATCAAGATTTACA
                      ____________________________________________________________
consensus AGCTCATATTCCACCCTATCATCGGGATGAGGGACAGCTTCTCTCCAATCAAGATTTACA
 
. : . : . : . : . : . :
JMFF050H09+ TGAACCATTTCCCCATCCTTGACCGCCTTCTTCAACTTCTCCCCAAAACTTTTCTCAATA
JMFF041H09+ TGAACCATTTCCCCATCCTTGACCGCCTTCTTCAACTTCTCCCCAAAACTTTTCTCAATA
JMSF036M14+ CCTTGACCGCCTTCTTCAACTTCTCCCCAAAACTTTTCTCAATA
JMFF049F12+ CCCAAAACTTTTCTCAATA
JMFF046I17+ CCCAAAACTTTTCTCAATA
JMFF031N13+ ACTTCTCCCCAAAACTTTTCTCAATA
JMSF041L14+ TGAACCATTTCCCCATCCTTGACCGCCTTCTTCAACTTCTCCCCAAAACTTTTCTCAATA
                      ____________________________________________________________
consensus TGAACCATTTCCCCATCCTTGACCGCCTTCTTCAACTTCTCCCCAAAACTTTTCTCAATA
 
. : . : . : . : . : . :
JMFF050H09+ AGAGCAGACGGAATCGTTATGTTCTCCACGTAATTCGAAGAAGAACCATCCTCTTCAGGA
JMFF041H09+ AGAGCAGACGGAATCGTTATGTTCTCCACGTAATTCGAAGAAGAACCATCCTCTTCAGGA
JMSF036M14+ AGAGCAGACGGAATCGTTATGTTCTCCACGTAATTCGAAGAAGAACCATCCTCTTCAGGA
JMFF049F12+ AGAGCAGACGGAATCGTTATGTTCTCCACGTAATTCGAAGAAGAACCATCCTCTTCAGGA
JMFF046I17+ AGAGCAGACGGAATCGTTATGTTCTCCACGTAATTCGAAGAAGAACCATCCTCTTCAGGA
JMFF031N13+ AGAGCAGACGGAATCGTTATGTTCTCCACGTAATTCGAAGAAGAACCATCCTCTTCAGGA
JMSF041L14+ AGAGCAGACGGAATCGTTATGTTCTCCACGTAATTCGAAGAAGAACCATCCTCTTCAGGA
                      ____________________________________________________________
consensus AGAGCAGACGGAATCGTTATGTTCTCCACGTAATTCGAAGAAGAACCATCCTCTTCAGGA
 
. : . : . : . : . : . :
JMFF050H09+ GAGTCCATGGTTATCAACCTTTCCTCAACATCATCCGCAACTAAGATCGCTGAAGCACCA
JMFF041H09+ GAGTCCATGGTTATCAACCTTTCCTCAACATCATCCGCAACTAAGATCGCTGAAGCACCA
JMSF036M14+ GAGTCCATGGTTATCAACCTTTCCTCAACATCATCCGCAACTAAGATCGCTGAAGCACCA
JMFF049F12+ GAGTCCATGGTTATCAACCTTTCCTCAACATCATCCGCAACTAAGATCGCTGAAGCACCA
JMFF046I17+ GAGTCCATGGTTATCAACCTTTCCTCAACATCATCCGCAACTAAGATCGCTGAAGCACCA
JMFF031N13+ GAGTCCATGGTTATCAACCTTTCCTCAACATCATCCGCAACTAAGATCGCTGAAGCACCA
JMSF041L14+ GAGTCCATGGTTATCAACCTTTCCTCAACATCATCCGCAACTAAGATCGCTGAAGCACCA
                      ____________________________________________________________
consensus GAGTCCATGGTTATCAACCTTTCCTCAACATCATCCGCAACTAAGATCGCTGAAGCACCA
 
. : . : . : . : . : . :
JMFF050H09+ GCATTCTGAGCATTCCAGGCCTTCAACGCAAAACGGCAATCTCCGCGATCGACGATAACA
JMFF041H09+ GCATTCTGAGCATTCCAGGCCTTCAACGCAAAACGGCAATCTCCGCGATCGACGATAACA
JMSF036M14+ GCATTCTGAGCATTCCAGGCCTTCAACGCAAAACGGCAATCTCCGCGATCGACGATAACA
JMFF049F12+ GCATTCTGAGCATTCCAGGCCTTCAACGCAAAACGGCAATCTCCGCGATCGACGATAACA
JMFF049C19+ GAGCATTCCAGGCCTTCAACGCAAAACGGCAATCTCCGCGATCGACGATAACA
JMFF046I17+ GCATTCTGAGCATTCCAGGCCTTCAACGCAAAACGGCAATCTCCGCGATCGACGATAACA
JMFF031N13+ GCATTCTGAGCATTCCAGGCCTTCAACGCAAAACGGCAATCTCCGCGATCGACGATAACA
JMSF041L14+ GCATTCTGAGCATTCCAGGCCTTCAACGCAAAACGGCAATCTCCGCGATCGACGATAACA
                      ____________________________________________________________
consensus GCATTCTGAGCATTCCAGGCCTTCAACGCAAAACGGCAATCTCCGCGATCGACGATAACA
 
. : . : . : . : . : . :
JMFF050H09+ AAGGTGGGCAAGGAACCGGCCTTGGAACTGAAAGAAAACCCAAAACCATCAAAGCCCTTA
JMFF041H09+ AAGGTGGGCAAGGAACCGGCCTTGGAACTGAAAGAAAACCCAAAACCATCAAAGCCCTTA
JMSF036M14+ AAGGTGGGCAAGGAACCGGCCTTGGAACTGAAAGAAATCCCAAAACCATCAAAGCCCTTA
JMFF049F12+ AAGGTGGGCAAGGAACCGGCCTTGGAACTGAAAGAAATCCCAAAACCATCAAAGCCCTTA
JMFF049C19+ AAGGTGGGCAAGGAACCGGCCTTGGAACTGAAAGAAATCCCAAAACCATCAAAGCCCTTA
JMFF046I17+ AAGGTGGGCAAGGAACCGGCCTTGGAACTGAAAGAAATCCCAAAACCATCAAAGCCCTTA
JMFF031N13+ AAGGTGGGCAAGGAACCGGCCTTGGAACTGAAAGAAAACCCAAAACCATCAAAGCCCTTA
JMSF041L14+ AAGGTGGGCAAGGAACCGGCCTTGGAACTGAAAGAAATCCCAAAACCATCAAAGCCCTTA
                      ____________________________________________________________
consensus AAGGTGGGCAAGGAACCGGCCTTGGAACTGAAAGAAATCCCAAAACCATCAAAGCCCTTA
 
. : . : . : . : . : . :
JMFF050H09+ CACCCCTTTCGATTATCCTTTGGGTAGACCACAGTCCCAGTCATGCTGCCGCCATACTGA
JMFF041H09+ CACCCCTTTCGATTATCCTTTGGGTAGACCACAGTCCCAGTCATGCTGCCGCCATACTGA
JMSF036M14+ CACCCCTTTCGATTATCCTTTGGGTAGACCACAGTCCCAGTCATGCTGCCGCCATACTGA
JMFF049F12+ CACCCCTTTCGATTATCCTTTGGGTAGACCACAGTCCCAGTCATGCTGCCGCCATACTGA
JMFF049C19+ CACCCCTTTCGATTATCCTTTGGGTAGACCACAGTCCCAGTCATGCTTCCGCCATACTGA
JMFF046I17+ CACCCCTTTCGATTATCCTTTGGGTAGACCACAGTCCCAGTCATGCTGCCGCCATACTGA
JMFF031N13+ CACCCCTTTCGATTATCCTTTGGGTAGACCACAGTCCCAGTCATGCTGCCGCCATACTGA
JMSF041L14+ CACCCCTTTCGATTATCCTTTGGGTAGACCACAGTCCCAGTCATGCTGCCGCCATACTGA
                      ____________________________________________________________
consensus CACCCCTTTCGATTATCCTTTGGGTAGACCACAGTCCCAGTCATGCTGCCGCCATACTGA
 
. : . : . : . : . : . :
JMFF050H09+ GGAATCCCGAAGTTGCCAAGAGCAGAATCGTAAGTTCCTTTGATGGAGTCAGGGGAGAAG
JMFF041H09+ GGAATCCCGAAGTTGCCAAGAGCAGAATCGTAAGTTCCTTTGATGGAGTCAGGGGAGAAG
JMSF036M14+ GGAATCCCGAAGTTGCCAAGAGCAGAATCGTAAGTTCCTTTGATGGAGTCAGGGGAGAAG
JMFF049F12+ GGAATCCCGAAGTTGCCAAGAGCAGAATCGTAAGTTCCTTTGATGGAGTCAGGGGAGAAG
JMFF049C19+ GGAATCCCGAAGTTGCCAAGAGCAGAATCGTAAGTTCCTTTGATGGAGTCAGGGGAGAAG
JMFF046I17+ GGAATCCCGAAGTTGCCAAGAGCAGAATCGTAAGTTCCTTTGATGGAGTCAGGGGAGAAG
JMFF031N13+ GGAATCCCGAAGTTGCCAAGAGCAGAATCGTAAGTTCCTTTGATGGAGTCAGGGGAGAAG
JMFF009O09+ CCAAGAGCAGAATCGTAAGTTCCTTTGATGGAGTCAGGGGAGAAG
JMSF041L14+ GGAATCCCGAAGTTGCCAAGAGCAGAATCGTAAGTTCCTTTGATGGAGTCAGGGGAGAAG
                      ____________________________________________________________
consensus GGAATCCCGAAGTTGCCAAGAGCAGAATCGTAAGTTCCTTTGATGGAGTCAGGGGAGAAG
 
. : . : . : . : . : . :
JMFF050H09+ ACCTTCAAGTTGTTCTTCTCCACCACGAACCTCCCGGCCGCAGATTCCAGCAGAGTCAAC
JMFF041H09+ ACCTTCAAGTTGTTCTTCTCCACCACGAACCTCCCGGCCGCAGATTCCAGCAGAGTCAAC
JMSF036M14+ ACCTTCAAGTTGTTCTTCTCCACCACGAACCTCCCGGCCGCAGATTCCAGCAGAGTCAAC
JMFF049F12+ ACCTTCAAGTTGTTCTTCTCCACCACGAACCTCCCGGCCGCAGATTCCAGCAGAGTCAAC
JMFF049C19+ ACCTTCAAGTTGTTCTTCTCCACCACGAACCTCCCGGCCGCAGATTCCAGCAGAGTCAAC
JMFF046I17+ ACCTTCAAGTTGTTCTTCTCCACCACGAACCTCCCGGCCGCAGATTCCAGCAGAGTCAAC
JMFF031N13+ ACCTTCAAGTTGTTCTTCTCCACCACGAACCTCCCGGCCGCAGATTCCAGCAGAGTCAAC
JMFF009O09+ ACCTTCAAGTTGTTNTTCTCCACCACGAACCTCCCGGCCGCAGATTCCAGCAGAGTCAAC
JMSF041L14+ ACCTTCAAGTTGTTCTTCTCCACCACGAACCTCCCGGCCGCAGATTCCAGCAGAGTCAAC
                      ____________________________________________________________
consensus ACCTTCAAGTTGTTCTTCTCCACCACGAACCTCCCGGCCGCAGATTCCAGCAGAGTCAAC
 
. : . : . : . : . : . :
JMFF050H09+ AGTAGCAACCCTAGCAAGATTGGGGCTTTGGGTTTTTCAGAAGCTCCCATTTCC
JMFF041H09+ AGTAGCAACCCTAGCAAGATTGGGGCTTTGGGTTTTTCAGAAGCTCCCATTTCC
JMSF036M14+ AGTAGCAACCCTAGCAAGATTGGGGCTTTGGGTTTTTCAGAAGCTCCCATTTCCACTGAT
JMFF049F12+ AGTAGCAACCCTAGCAAGATTGGGGCTTTGGGTTTTTCAGAAGCTCCCATTTCCACTGAT
JMFF049C19+ AGTAGCAACCCTAGCAAGATTGGGGCTTTGGGTTTTTCAGAAGCTCCCATTTCCACTGAT
JMFF046I17+ AGTAGCAACCCTAGCAAGATTGGGGCTTTGGGTTTTTCAGAAGCTCCCATTTCCACTGAT
JMFF031N13+ AGTAGCAACCCTAGCAAGATTGGGGCTTTGGGTTTTTCAGAAGCTCCCATTTCC
JMFF009O09+ AGTAGCAACCCTAGCAAGATTGGGGCTTTGGGTTTTTCAGAAGCTCCCATTTCCACTGAT
JMSF041L14+ AGTAGCAACCCTAGCAAGATTGGGGCTTTGGGTTTTTCAGAAGCTCCCATTTCCACTGAT
                      ____________________________________________________________
consensus AGTAGCAACCCTAGCAAGATTGGGGCTTTGGGTTTTTCAGAAGCTCCCATTTCCACTGAT
 
. : . : . : . : . : . :
JMSF036M14+ TTCCAAGAGAAGGAAGGATAGATGTGAACAGAAAGGCAGTAGCTTGGAGCTGTAAAGAAG
JMFF049F12+ TTCCAAGAGAAGGAAGGATAGATGTGAACAGAAAGGCAGTAGCTTGGAGCTGTAAAGAAG
JMFF049C19+ TTCCAAGAGAAGGAAGGATAGATGTGAACAGAAAGGCAGTAGCTTGGAGCTGTAAAGAAG
JMFF046I17+ TTCCAAGAGAAGGAAGGATAGATGTGAACAGAAAGGCAGTAGCTTGGAGCTGTAAAGAAG
JMFF009O09+ TTCCAAGAGAAGGAAGGATAGATGTGAACAGAAAGGCAGTAGCTTGGAGCTGTAAAGAAG
JMSF041L14+ TTCCAAGAGAAGGAAGGATAGATGTGAACAGAAAGGCAGTAGCTTGGAGCTGTAAAGAAG
                      ____________________________________________________________
consensus TTCCAAGAGAAGGAAGGATAGATGTGAACAGAAAGGCAGTAGCTTGGAGCTGTAAAGAAG
 
. : . : . : . : . : . :
JMSF036M14+ ACGAAGTTTCTTCCTCTGGGCTCCTTCCTTACTGT
JMFF049F12+ ACGAAGTTTCTTCCTCTGGGCTCCTTCCTTACTGTGACAGGATTAGCCTGTCCCCT
JMFF049C19+ ACGAAGTTTCTTCCTCTGGGCTCCTTCCTTACTGTGACAGGATTAGCCTGTCCCCTAT
JMFF046I17+ ACGAAGTTTCTTCCTCTGGGCTCCTTCCTTACTGTGACAGGATTAGCCTGTCCCCTAT
JMFF009O09+ ACGAAGTTTCTTCCTCTGGGCTCCTTCCTTACTGTGACAGGATTAGCCTGTCCCCTAT
JMSF041L14+ ACGAAGTTTCTTCCTCTGGGCTCCTTCCTTACTGTGACAGGATTAGCCTGTCCCCTATTC
                      ____________________________________________________________
consensus ACGAAGTTTCTTCCTCTGGGCTCCTTCCTTACTGTGACAGGATTAGCCTGTCCCCTATTC