Previous Contig 007430:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038F22Sequence542007430 (2)714013361 (3)
JMSF041J20Sequence758007430 (2)617013361 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041J20+ ACAATATATATATGAGTAGGGTACTTAGCTCTTGATCA
                      ____________________________________________________________
consensus ACAATATATATATGAGTAGGGTACTTAGCTCTTGATCA
 
. : . : . : . : . : . :
JMSF041J20+ TATAGATGATTGTTTGTTGTGCTGCAGCCGGAGTCTCCCGTTTACAGAAGCAACCTTTCC
                      ____________________________________________________________
consensus TATAGATGATTGTTTGTTGTGCTGCAGCCGGAGTCTCCCGTTTACAGAAGCAACCTTTCC
 
. : . : . : . : . : . :
JMFF038F22+ GGTCAGAAACGTTCG
JMSF041J20+ AGTTTGAGGGATCAACTCCATGGTCAACGCCACTACCAACTCCTTGGTCAGAAACGTTCG
                      ____________________________________________________________
consensus AGTTTGAGGGATCAACTCCATGGTCAACGCCACTACCAACTCCTTGGTCAGAAACGTTCG
 
. : . : . : . : . : . :
JMFF038F22+ ATCGCCGGGAATTCATCGCCGATAAACAAACAGAGCATCAAGGAAGGATCATCGGGGATC
JMSF041J20+ ATCGCCGGGAATTCATCGCCGATAAACAAACAGAGCATCAAGGAAGGATCATCGGGGATC
                      ____________________________________________________________
consensus ATCGCCGGGAATTCATCGCCGATAAACAAACAGAGCATCAAGGAAGGATCATCGGGGATC
 
. : . : . : . : . : . :
JMFF038F22+ AACAAACTGAGCATCAGGGAAGGATCGTGAACCCGCCCCGGCCCCAATCAGAGCCTCAGA
JMSF041J20+ AACAAACTGAGCATCAGGGAAGGATCGTGAACCCGCCCCGGCCCCAATCAGAGCCTCAGA
                      ____________________________________________________________
consensus AACAAACTGAGCATCAGGGAAGGATCGTGAACCCGCCCCGGCCCCAATCAGAGCCTCAGA
 
. : . : . : . : . : . :
JMFF038F22+ TTGTCCATGCATCACCGCAAGAAGCCGCCGAGGACGAAATCTGAATCGCGACGCGATTGA
JMSF041J20+ TTGTCCATGCATCACCGCAAGAAGCCGCCGAGGACGAAATCTGAATCGCGACGCGATTGA
                      ____________________________________________________________
consensus TTGTCCATGCATCACCGCAAGAAGCCGCCGAGGACGAAATCTGAATCGCGACGCGATTGA
 
. : . : . : . : . : . :
JMFF038F22+ TTGCAACTGACCGCCGATCTTGAAAATGGGGGTTGCGATCATGTTGCTGAGAGACGTTGA
JMSF041J20+ TTGCAACTGACCGCCGATCTTGAAAATGGGGGTTGCGATCATGTTGCTGAGAGACGTTGA
                      ____________________________________________________________
consensus TTGCAACTGACCGCCGATCTTGAAAATGGGGGTTGCGATCATGTTGCTGAGAGACGTTGA
 
. : . : . : . : . : . :
JMFF038F22+ GGCCTTGCGAAGGCAGAGGAGTGATGTCGCCGGTCCGATCGTCGATCAACCGTCTGGGTT
JMSF041J20+ GGCCTTGCGAAGGCAGAGGAGTGATGTCGCCGGTCCGATCGTCGATCAACCGTCTGGGTT
                      ____________________________________________________________
consensus GGCCTTGCGAAGGCAGAGGAGTGATGTCGCCGGTCCGATCGTCGATCAACCGTCTGGGTT
 
. : . : . : . : . : . :
JMFF038F22+ TCCGATCGGTGATGGCCGCGAAG
JMSF041J20+ TCCGATCGGTGATGGCCGCGAAGATCGATCGGCGCGACGGCTGAGGCCTTGGATCGCCGG
                      ____________________________________________________________
consensus TCCGATCGGTGATGGCCGCGAAGATCGATCGGCGCGACGGCTGAGGCCTTGGATCGCCGG
 
. : . : . : . : . : . :
JMSF041J20+ CTGATCCTAGGGCGGAGAGGTCGAGGCGGTTCGGTGACCTCTCGTCGGGGAATGGGCTGG
                      ____________________________________________________________
consensus CTGATCCTAGGGCGGAGAGGTCGAGGCGGTTCGGTGACCTCTCGTCGGGGAATGGGCTGG
 
. : . : . : . : . : . :
JMSF041J20+ AGTGGTGCCTCCGCTGCTCACTCCATCTATTGGAACGGTGCCGACCGACCGCTTTTCACC
                      ____________________________________________________________
consensus AGTGGTGCCTCCGCTGCTCACTCCATCTATTGGAACGGTGCCGACCGACCGCTTTTCACC
 
. : . : . : . : . : . :
JMSF041J20+ GAACATCTCCGTAACGTCTCCGATCGATAATCGTTGGATAGAGCATCACTGCTGATAACG
                      ____________________________________________________________
consensus GAACATCTCCGTAACGTCTCCGATCGATAATCGTTGGATAGAGCATCACTGCTGATAACG
 
. : . : . : . : . : . :
JMSF041J20+ TGTTGGAAAGTAAAAATAGAATAGAGAAAAAAAAGGGGAATCTCATATTCATCCATCTCC
                      ____________________________________________________________
consensus TGTTGGAAAGTAAAAATAGAATAGAGAAAAAAAAGGGGAATCTCATATTCATCCATCTCC