Previous Contig 007428:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF041I21Sequence810007428 (2)gb:BT002072_16356755e-76Arabidopsis thaliana Unknown protein (At2g34090) mRNA, complete cds.>gb:BT015789704013353 (2)gb:BT002072_16356752e-48Arabidopsis thaliana Unknown protein (At2g34090) mRNA, complete cds.>gb:BT015789
JMSF051N24Sequence652007428 (2)gb:BT002072_16356756e-53Arabidopsis thaliana Unknown protein (At2g34090) mRNA, complete cds.>gb:BT015789724013353 (2)gb:BT002072_16356752e-54Arabidopsis thaliana Unknown protein (At2g34090) mRNA, complete cds.>gb:BT015789

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041I21+ CAAGACTTTCGGTTNGGAATATCAGAAACA
                      ____________________________________________________________
consensus CAAGACTTTCGGTTNGGAATATCAGAAACA
 
. : . : . : . : . : . :
JMSF041I21+ CGTGAAAACAAAAAGATTGCAGCATCTAGAGACTGAAAAAATGTCCGTGCTCCTGCAAAG
                      ____________________________________________________________
consensus CGTGAAAACAAAAAGATTGCAGCATCTAGAGACTGAAAAAATGTCCGTGCTCCTGCAAAG
 
. : . : . : . : . : . :
JMSF041I21+ AAAAAATTCCCAATGCTTCCATTACTAAAACAAAACAAGTCTTCTGAGCGCCGAAGAATC
                      ____________________________________________________________
consensus AAAAAATTCCCAATGCTTCCATTACTAAAACAAAACAAGTCTTCTGAGCGCCGAAGAATC
 
. : . : . : . : . : . :
JMSF041I21+ TGGTCTTGAAAGTAAGCCAAGAAAGCTCGTATAGTTTCCCTGTAAGGTTTTGAGATGCCT
                      ____________________________________________________________
consensus TGGTCTTGAAAGTAAGCCAAGAAAGCTCGTATAGTTTCCCTGTAAGGTTTTGAGATGCCT
 
. : . : . : . : . : . :
JMSF051N24+ TACCAC
JMSF041I21+ TTCCAAAGGTTATGGTTCCCTTCCACAATATCATACTCAAAAATATGGTTTCACTACCAC
                      ____________________________________________________________
consensus TTCCAAAGGTTATGGTTCCCTTCCACAATATCATACTCAAAAATATGGTTTCACTACCAC
 
. : . : . : . : . : . :
JMSF051N24+ TCTAGCTTTGCTTTTTGTGCATCAAGAGGTAGTCGATGACCAAGCAATGTTCTCACAGCA
JMSF041I21+ TCTAGCTTTGCTTTTTGTGCATCAAGAGGTAGTCGATGACCAAGCAATGTTCTCACAGCA
                      ____________________________________________________________
consensus TCTAGCTTTGCTTTTTGTGCATCAAGAGGTAGTCGATGACCAAGCAATGTTCTCACAGCA
 
. : . : . : . : . : . :
JMSF051N24+ AGGGCCTCAGAGGTACTTTGATCAGACAGTCTCAAGCATCTTGACCGTATGTCCCCAACT
JMSF041I21+ AGGGCCTCAGAGGTACTTTGATCAGACAGTCTCAAGCATCTTGACCGTATGTCCCCAACT
                      ____________________________________________________________
consensus AGGGCCTCAGAGGTACTTTGATCAGACAGTCTCAAGCATCTTGACCGTATGTCCCCAACT
 
. : . : . : . : . : . :
JMSF051N24+ GCAGGGCCACCAAGAACTCGGACAATCTCAGCTGTACTTCCACCATCATCAGAAACAGGA
JMSF041I21+ GCAGGGCCACCAAGAACTCGGACAATCTCAGCTGTACTTCCACCATCATCAGAAACAGGA
                      ____________________________________________________________
consensus GCAGGGCCACCAAGAACTCGGACAATCTCAGCTGTACTTCCACCATCATCAGAAACAGGA
 
. : . : . : . : . : . :
JMSF051N24+ AGAACATGAGCAACACAAGTAGTTAACTTCTTAAGCTCTTCGGCAACACCATTAAAGGCT
JMSF041I21+ AGAACATGAGCAACACAAGTAGTTAACTTCTTAAGCTCTTCGGCAACACCATTAAAGGCT
                      ____________________________________________________________
consensus AGAACATGAGCAACACAAGTAGTTAACTTCTTAAGCTCTTCGGCAACACCATTAAAGGCT
 
. : . : . : . : . : . :
JMSF051N24+ GTTCCACCCGAGAAAACCACCAGTGAGGGCTGATGAGCAGTGGGTACGGAGGAGTGGCAG
JMSF041I21+ GTTCCACCCGAGAAAACCACCAGTGAGGGCTGATGAGCAGTGGGTACGGAGGAGTGGCAG
                      ____________________________________________________________
consensus GTTCCACCCGAGAAAACCACCAGTGAGGGCTGATGAGCAGTGGGTACGGAGGAGTGGCAG
 
. : . : . : . : . : . :
JMSF051N24+ TTGTGCGTGGGAGAGGTACGAGCGGAGGAAGCCATGAGAGAGAAGGAGAGAGATCTGTCT
JMSF041I21+ TTGTGCGTGGGAGAGGTACGAGCGGAGGAAGCCATGAGAGAGAAGGAGAGAGATCTGTCT
                      ____________________________________________________________
consensus TTGTGCGTGGGAGAGGTACGAGCGGAGGAAGCCATGAGAGAGAAGGAGAGAGATCTGTCT
 
. : . : . : . : . : . :
JMSF051N24+ CTGCTGCTGCTGCTTCTAGAAGGCGAAGAGAGACAAATAGGATGGAAATGGAAGAGAGAA
JMSF041I21+ CTGCTGCTGCTGCTTCTAGAAGGCGAAGAGAGACAAATAGGATGGAAATGGAAGAGAGAA
                      ____________________________________________________________
consensus CTGCTGCTGCTGCTTCTAGAAGGCGAAGAGAGACAAATAGGATGGAAATGGAAGAGAGAA
 
. : . : . : . : . : . :
JMSF051N24+ AACGGGAAAGAAGTAAAGGCATTTAAGGAAGGAATAGAGAAGGGGGGTCCCAAACAAGTG
JMSF041I21+ AACGGGAAAGAAGTAAAGGCATTTAAGGAAGGAATAGAGAAGGGGGGTCCCAAACAAGTG
                      ____________________________________________________________
consensus AACGGGAAAGAAGTAAAGGCATTTAAGGAAGGAATAGAGAAGGGGGGTCCCAAACAAGTG
 
. : . : . : . : . : . :
JMSF051N24+ TCCGCCATAATTCCCCTCCCGCACAACCCACGCCAACATACCAAAGACCAAAATGTTACC
JMSF041I21+ TCCGCCATAATTCCCCTCCCGCACAACCCACGCCAACATACCAAAGACCAAAATGTTACC
                      ____________________________________________________________
consensus TCCGCCATAATTCCCCTCCCGCACAACCCACGCCAACATACCAAAGACCAAAATGTTACC