Previous Contig 007427:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF051A16Sequence566007427 (3)583011048 (3)pir|E86362|E863623e-08hypothetical protein F19G10.18 - Arabidopsis thaliana>gb:AE005172_891238 Arabido
JMSF003O01Sequence311007427 (3)738011048 (3)pir|E86362|E863624e-45hypothetical protein F19G10.18 - Arabidopsis thaliana>gb:AE005172_891238 Arabido
JMSF041I10Sequence797007427 (3)pir|E86362|E863622e-27hypothetical protein F19G10.18 - Arabidopsis thaliana>gb:AE005172_891238 Arabido812011048 (3)gb:AC084818_17338561e-93Oryza sativa (japonica cultivar-group) chromosome 5 clone P0668H12, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041I10+ TCCATCATTAGCATAAC
                      ____________________________________________________________
consensus TCCATCATTAGCATAAC
 
. : . : . : . : . : . :
JMSF041I10+ CTTCCATTCCTTACACAGTATTTTCATCAGCGGTGGCCCGGACAAATCAGGCAGCGAAAA
                      ____________________________________________________________
consensus CTTCCATTCCTTACACAGTATTTTCATCAGCGGTGGCCCGGACAAATCAGGCAGCGAAAA
 
. : . : . : . : . : . :
JMSF041I10+ TAACAACCCACTCTGCCCACTTGAACAAGAATATAAATAATATCCATTTCTCGTGCCAAA
                      ____________________________________________________________
consensus TAACAACCCACTCTGCCCACTTGAACAAGAATATAAATAATATCCATTTCTCGTGCCAAA
 
. : . : . : . : . : . :
JMSF041I10+ AATTATCGAATCATCCACCCAAGCTAAACTATTAATTCCCTCAGAAACACCCGGAAATTC
                      ____________________________________________________________
consensus AATTATCGAATCATCCACCCAAGCTAAACTATTAATTCCCTCAGAAACACCCGGAAATTC
 
. : . : . : . : . : . :
JMFF051A16+ AAAGATCCACTGAAAACCAACTCAACTAGCACTAATTTCTCCCCAAC
JMSF041I10+ CTTCAGAATCACTAAAGATCCACTGAAAACCAACTCAACTAGCACTAATTTCTTCCCAAC
                      ____________________________________________________________
consensus CTTCAGAATCACTAAAGATCCACTGAAAACCAACTCAACTAGCACTAATTTCTTCCCAAC
 
. : . : . : . : . : . :
JMFF051A16+ AGCAACCGCAAAGAAACACCCGTCTTCTTTCAGTNTCATCCCATTTAACCGCTGTACAAC
JMSF041I10+ AGCAACCGCAAAGAAACACCCGTCTTCTTTCAGTTTCATCCCATTTAACCGCTGTACAAC
                      ____________________________________________________________
consensus AGCAACCGCAAAGAAACACCCGTCTTCTTTCAGTTTCATCCCATTTAACCGCTGTACAAC
 
. : . : . : . : . : . :
JMFF051A16+ ATTGTCG---CCAGCGCTGATCCTACTACTTCGAAATCTCCGAGTTAGAGCAGTAACCCC
JMSF041I10+ ATTGTCGCCACCAGTGCTGATCCTACTACTTCGAAATCTCCGAGTTAGAGCAGTAACCCC
                      ____________________________________________________________
consensus ATTGTCGCCACCAGTGCTGATCCTACTACTTCGAAATCTCCGAGTTAGAGCAGTAACCCC
 
. : . : . : . : . : . :
JMFF051A16+ CTTGATCAGACTGAGTTTCTTAATCGGGTCAAGCAAAAGCAAATCAACTAAGTAAAGAAA
JMSF041I10+ CTTGATCAGACTGAGTTTCTTAATCGGGTCAAGCAAAAGCAAATCAACTAAGTAAAGAAA
                      ____________________________________________________________
consensus CTTGATCAGACTGAGTTTCTTAATCGGGTCAAGCAAAAGCAAATCAACTAAGTAAAGAAA
 
. : . : . : . : . : . :
JMSF003O01+ TCATCGAGGACGTGAATTGAATTTACAGG
JMFF051A16+ TCCATCCGACACTACAATTATTTTACCGATATCATCGAGGACGTGAATTGAATTTACAGG
JMSF041I10+ TCCATCCGACACTACAATTATTTTACCGATATCATCGAGGACGTGAATTGAATTTACAGG
                      ____________________________________________________________
consensus TCCATCCGACACTACAATTATTTTACCGATATCATCGAGGACGTGAATTGAATTTACAGG
 
. : . : . : . : . : . :
JMSF003O01+ GCCGCCACCGACAGTGACTTGGCGGTGACAAACTAGAGCCGAGGAGGTGCTGGGAGAGTT
JMFF051A16+ GCCGCCACCGACAGTGACTTGGCGGTGACAAACTAGAGCCGAGGAGGTGCTGGGAGAGTT
JMSF041I10+ GCCGCCACCGACAGTGACTTGGCGGTGACAAACTAGAGCCGAGGAGGTGCTGGGAGAGTT
                      ____________________________________________________________
consensus GCCGCCACCGACAGTGACTTGGCGGTGACAAACTAGAGCCGAGGAGGTGCTGGGAGAGTT
 
. : . : . : . : . : . :
JMSF003O01+ AGGGTTTACAGATAGCGAGAGCAGAGAGCCCGAAGTCGTGCCAAGGTAGATTAATGCTTG
JMFF051A16+ AGGGTTTACAGATAGCGAGAGCAGAGAGCCCGAAGTCGTGCCAAGGTAGATTAATGCTTG
JMSF041I10+ AGGGTTTACAGATAGCGAGAGCAGAGAGCCCGAAGTCGTGCCAAGGTAGATTAATGCTTG
                      ____________________________________________________________
consensus AGGGTTTACAGATAGCGAGAGCAGAGAGCCCGAAGTCGTGCCAAGGTAGATTAATGCTTG
 
. : . : . : . : . : . :
JMSF003O01+ GGAATCGGAAAGCGTGGAGATTGCGAGAGATCGAATTTGAGAGGAATTGGAATCTAAAGG
JMFF051A16+ GGAATCGGAAAGCGTGGAGATTGCGAGAGATCGAATTTGAGAGGAATTGGAATCTAAAGG
JMSF041I10+ GGAATCGGAAAGCGTGGAGATTGCGAGAGATCGAATTTGAGAGGAATTGGAATCTAAAGG
                      ____________________________________________________________
consensus GGAATCGGAAAGCGTGGAGATTGCGAGAGATCGAATTTGAGAGGAATTGGAATCTAAAGG
 
. : . : . : . : . : . :
JMSF003O01+ GTTGAACTCTGCAAGGAGCTTGAGAACAGTACGGGAACGGGACTTGGATTCCGGTTCGGG
JMFF051A16+ GTTGAACTCTGCAAGGAGCTTGAGAACAGTACGGGAACGGGACTTGGATTCCGGTTCGGG
JMSF041I10+ GTTGAACTCTGCAAGGAGCTTGAGAACAGTACGGGAACGGGACTTGGATTCCGGTTCGGG
                      ____________________________________________________________
consensus GTTGAACTCTGCAAGGAGCTTGAGAACAGTACGGGAACGGGACTTGGATTCCGGTTCGGG
 
. : . : . : . : . : . :
JMSF003O01+ TTTGGTGCTGGGTTTCGGATTCGCCATCGGAGGAATCCAGT
JMFF051A16+ TTTGGTGCTGGGTTTCGGATTCGCCATCGGAGGAATCCAGT
JMSF041I10+ TTTGGTGCTGGGTTTCGGATTCGCCATCGGAGGAATCCAGTGGGCAGCAACAAGAACCCC
                      ____________________________________________________________
consensus TTTGGTGCTGGGTTTCGGATTCGCCATCGGAGGAATCCAGTGGGCAGCAACAAGAACCCC