Previous Contig 007425:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039O16Sequence548007425 (5)gb:AY555190_16135831e-55Vitis vinifera Myb transcription factor (MybCs1) mRNA, complete cds.669007425 (5)
JMFN019K23Sequence610007425 (5)gb:AY555190_16135831e-55Vitis vinifera Myb transcription factor (MybCs1) mRNA, complete cds.
JMFN039E07Sequence615007425 (5)gb:AF336278_17875758e-54Gossypium hirsutum BNLGHi233 (bnlghi6233) mRNA, complete cds.
JMSF041H19Sequence630007425 (5)gb:AY555190_16135831e-55Vitis vinifera Myb transcription factor (MybCs1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF039O16- CTTCACTGACT
                      ____________________________________________________________
consensus CTTCACTGACT
 
. : . : . : . : . : . :
rJMFF039O16- TTTTGTTACAGCTACAATTACACAACACAACTTTACATTTACTGACTAGACTAAGCTAGA
                      ____________________________________________________________
consensus TTTTGTTACAGCTACAATTACACAACACAACTTTACATTTACTGACTAGACTAAGCTAGA
 
. : . : . : . : . : . :
rJMFF039O16- TAGTCCGCAGTAAAATTACTCATTAACCACTCCATTATTACTCACGTAATTTTAATTAAT
                      ____________________________________________________________
consensus TAGTCCGCAGTAAAATTACTCATTAACCACTCCATTATTACTCACGTAATTTTAATTAAT
 
. : . : . : . : . : . :
rJMFF039O16- TTAATTTAGACTCGAATTATTGCTCGATGTCGGGGCTACATTATAATCCACAAAAGGATA
                      ____________________________________________________________
consensus TTAATTTAGACTCGAATTATTGCTCGATGTCGGGGCTACATTATAATCCACAAAAGGATA
 
. : . : . : . : . : . :
rJMFF039O16- ATCGCACAAACAATCATCGGTCAAAGGTTCAAAGCAATTCTCGGAAAGAAGGTGAAGATA
                      ____________________________________________________________
consensus ATCGCACAAACAATCATCGGTCAAAGGTTCAAAGCAATTCTCGGAAAGAAGGTGAAGATA
 
. : . : . : . : . : . :
rJMFF039O16- CTCATCGTACACTTTTTCCAGCAAGCCATCACTGGTGGGGCCCGAGCACTTGGGGGAGGA
                      ____________________________________________________________
consensus CTCATCGTACACTTTTTCCAGCAAGCCATCACTGGTGGGGCCCGAGCACTTGGGGGAGGA
 
. : . : . : . : . : . :
rJMFF039O16- GAGATCACAGCCGTCCAGAATTTGATCACAGAAGTCCACGTCTCCTCCTAGCTCATACAA
                      ____________________________________________________________
consensus GAGATCACAGCCGTCCAGAATTTGATCACAGAAGTCCACGTCTCCTCCTAGCTCATACAA
 
. : . : . : . : . : . :
rJMFF039O16- GTGCCACGGGATGAACGGCGGCGGCGGCGGCTCCGCTGTAGTACCCTGTAGTACTACTGC
                      ____________________________________________________________
consensus GTGCCACGGGATGAACGGCGGCGGCGGCGGCTCCGCTGTAGTACCCTGTAGTACTACTGC
 
. : . : . : . : . : . :
rJMFF039O16- TTTGTTGTCAACCTCGCCGGAGCTGGAGGAGACGCTCCCGGCGACGTCTTCGAGGCTGTG
                      ____________________________________________________________
consensus TTTGTTGTCAACCTCGCCGGAGCTGGAGGAGACGCTCCCGGCGACGTCTTCGAGGCTGTG
 
. : . : . : . : . : . :
rJMFF039O16- GTTCCTCGAGAACGCCGGCGACGGCGAGAGCCTGATGGGCTTCGGAGCGTAAACTTTTGT
JMFN019K23+ CGAGAACGCCGGCGACGGCGAGAGCCTGATGGGCTTCGGAGCGTAAACTTTTGT
                      ____________________________________________________________
consensus GTTCCTCGAGAACGCCGGCGACGGCGAGAGCCTGATGGGCTTCGGAGCGTAAACTTTTGT
 
. : . : . : . : . : . :
rJMFF039O16- CCTCTTCTCCGGCGCCGTCGCCGTCTGATCGGAGTCTTGCCGGGGAGATTGTTCGTCGTT
JMFN019K23+ CCTCTTCTCCGGCGCCGTCGCCGTCTGATCGGAGTCTTGCCGGGGAGATTGTTCGTCGTT
JMFF039O16+ GAGTCTTGCCGGGGAGATTGTTCGTCGTT
JMSF041H19+ GAGTCTTGCCGGGGAGATTGTTCGTCGTT
                      ____________________________________________________________
consensus CCTCTTCTCCGGCGCCGTCGCCGTCTGATCGGAGTCTTGCCGGGGAGATTGTTCGTCGTT
 
. : . : . : . : . : . :
rJMFF039O16- TCTAGCCTTCTTGTGCTTCTTTTTAGTATTGGCGGTGAGTTTCTGGGGATTTGGGCGG
JMFN019K23+ TCTAGCCTTCTTGTGCTTCTTTTTAGTATTGGCGGTGAGTTTCTGGGGATTTGGGCGGGG
JMFF039O16+ TCTAGCCTTCTTGTGCTTCTTTTTAGTATTGGCGGTGAGTTTCTGGGGATTTGGGCGGGG
JMSF041H19+ TCTAGCCTTCTTGTGCTTCTTTTTAGTATTGGCGGTGAGTTTCTGGGGATTTGGGCGGGG
                      ____________________________________________________________
consensus TCTAGCCTTCTTGTGCTTCTTTTTAGTATTGGCGGTGAGTTTCTGGGGATTTGGGCGGGG
 
. : . : . : . : . : . :
JMFN019K23+ TTTCGCCGGCTTTTTCTTGGAGTCTTTGGAGTGGCGGGGCTTGGGTTCGATCCCGGCGCT
JMFF039O16+ TTTCGCCGGCTTTTTCTTGGAGTCTTTGGAGTGGCGGGGCTTGGGTTCGATCCCGGCGCT
JMFN039E07+ TGGGCTCGATCCCGGAGCT
JMSF041H19+ TTTCGCCGGCTTTTTCTTGGAGTCTTTGGAGTGGCGGGGCTTGGGTTCGATCCCGGCGCT
                      ____________________________________________________________
consensus TTTCGCCGGCTTTTTCTTGGAGTCTTTGGAGTGGCGGGGCTTGGGTTCGATCCCGGCGCT
 
. : . : . : . : . : . :
JMFN019K23+ CTTGAGCTTCTTGAGGAGATGAGTGTTCCAGTAGTTCTTGATCTCATTGTCCGTTCGACC
JMFF039O16+ CTTGAGCTTCTTGAGGAGATGAGTGTTCCAGTAGTTCTTGATCTCATTGTCCGTTCGACC
JMFN039E07+ CTTGAGCTTCTTGAGGAGATGAGTGTTCCAGTAGTTCTTGATCTCATTGTCCGTTCGACC
JMSF041H19+ CTTGAGCTTCTTGAGGAGATGAGTGTTCCAGTAGTTCTTGATCTCATTGTCCGTTCGACC
                      ____________________________________________________________
consensus CTTGAGCTTCTTGAGGAGATGAGTGTTCCAGTAGTTCTTGATCTCATTGTCCGTTCGACC
 
. : . : . : . : . : . :
JMFN019K23+ TGGCAACCTGCCTGCAATGAGGGACCACCTGTTCCCCAGGAGTGAATGTAGCCGCACGAT
JMFF039O16+ TGGCAACCTGCCTGCAATGAGGGACCACCTGTTCCCCAGGAGTGAATGTAGCCGCACGAT
JMFN039E07+ TGGCAGCCTTCCTGCAATAAGGGACCATCTGTTCCCCAGAAGAGAATGGAGGCGCACGAT
JMSF041H19+ TGGCAACCTGCCTGCAATGAGGGACCACCTGTTCCCCAGGAGTGAATGTAGCCGCACGAT
                      ____________________________________________________________
consensus TGGCAACCTGCCTGCAATGAGGGACCACCTGTTCCCCAGGAGTGAATGTAGCCGCACGAT
 
. : . : . : . : . : . :
JMFN019K23+ CAAATCCTCCTCTTCCTGGCTGAAGTTCCCCCGTTTGATCCCCGGCCTCAAATAGTTCAT
JMFF039O16+ CAAATCCTCCTCTTCCTGGCTGAAGTTCCCCCGTTTGATCCCCGGCCTCAAATAGTTCAT
JMFN039E07+ AAGATCCTCCTCTTCCTGGCTGAAATTCCCCCGCTTGATCCCAGGCCGAAGATAATTCAT
JMSF041H19+ CAAATCCTCCTCTTCCTGGCTGAAGTTCCCCCGTTTGATCCCCGGCCTCAAATAGTTCAT
                      ____________________________________________________________
consensus CAAATCCTCCTCTTCCTGGCTGAAGTTCCCCCGTTTGATCCCCGGCCTCAAATAGTTCAT
 
. : . : . : . : . : . :
JMFN019K23+ CCATCTCAGCCTGCAACTCTTCCCACACCTAAGCAACCCAGCTTTCTTGGGCAAAGATCT
JMFF039O16+ CCATCTCAGCCTGCAACTCTTCCCACACCTAAGCAACCCAGCTTTCTTGGGCAAAGATCT
JMFN039E07+ CCATCTCAGCCTGCAACTCTTCCCACATCTTAGCAGTCCAGCTTTCTTGGGCAAAGATCT
JMSF041H19+ CCATCTCAGCCTGCAACTCTTCCCACACCTAAGCAACCCAGCTTTCTTGGGCAAAGATCT
                      ____________________________________________________________
consensus CCATCTCAGCCTGCAACTCTTCCCACACCTAAGCAACCCAGCTTTCTTGGGCAAAGATCT
 
. : . : . : . : . : . :
JMFN019K23+ CCATTGGCCTTCTCCATGGTGTTGAATGTGATTAGTGAGCAGCAAATCCTCCTTGGCAGA
JMFF039O16+ CCATTGGCCTTCTCCATGGTGTTGAATGTGATTAGTGAGCAGCAAATCCTCCTTGGCAGA
JMFN039E07+ CCATTGGCCTTCGCCATGTTGCTGAATGTAATTGGTGAGAAGTAAATCTTCTTTGGTAGA
JMSF041H19+ CCATTGGCCTTCTCCATGGTGTTGAATGTGATTAGTGAGCAGCAAATCCTCCTTGGCAGA
                      ____________________________________________________________
consensus CCATTGGCCTTCTCCATGGTGTTGAATGTGATTAGTGAGCAGCAAATCCTCCTTGGCAGA
 
. : . : . : . : . : . :
JMFN019K23+ CCAAGGCCCTTTTCTGAGCCCTTCTTTGGAGCAGCAAGGAGCTCTTCCCAT
JMFF039O16+ CCAAGGCCCTTTTCTGAGCCCTTCTTTGGAGCAGCAAGGAGCTCTTCCCAT
JMFN039E07+ CCAAGGGCCCTTCTTCAGCCCTTCCTTAGAACAGCAAGGAGCTCTTCCCAT
JMSF041H19+ CCAAGGCCCTTTTCTGAGCCCTTCTTTGGAGCAGCAAGGAGCTCTTCCCATGTCTGAATC
                      ____________________________________________________________
consensus CCAAGGCCCTTTTCTGAGCCCTTCTTTGGAGCAGCAAGGAGCTCTTCCCATGTCTGAATC
 
. : . : . : . : . : . :
JMSF041H19+ TGAGGGAGAAAAGTAATGAAGATGGGTTGGGTGGAGAATGAATAAGAGAGGAGGGTGAGA
                      ____________________________________________________________
consensus TGAGGGAGAAAAGTAATGAAGATGGGTTGGGTGGAGAATGAATAAGAGAGGAGGGTGAGA
 
. : . : . : . : . : . :
JMSF041H19+ AGTATATAAGGGAGGGAATAGGAGTTCACAACTCCACAAGTTTGTGCACAAGTCGTGCTC
                      ____________________________________________________________
consensus AGTATATAAGGGAGGGAATAGGAGTTCACAACTCCACAAGTTTGTGCACAAGTCGTGCTC