Previous Contig 007424:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS040E09Sequence622007424 (3)gb:AY062492_15651483e-05Arabidopsis thaliana putative VP1/ABI3 family regulatory protein (At2g30470; T6B
JMFS106G03Sequence632007424 (3)gb:AY062492_15651483e-31Arabidopsis thaliana putative VP1/ABI3 family regulatory protein (At2g30470; T6B
JMSF041H17Sequence446007424 (3)687023949gb:AP005296_18500575e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ17

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS106G03+ CTTG
                      ____________________________________________________________
consensus CTTG
 
. : . : . : . : . : . :
JMFS106G03+ CCTAATTGCAGAAGCCTTCCCTTTTCTAAAATATTCTCATCCATTCTATTTTCAACACGG
                      ____________________________________________________________
consensus CCTAATTGCAGAAGCCTTCCCTTTTCTAAAATATTCTCATCCATTCTATTTTCAACACGG
 
. : . : . : . : . : . :
JMFS106G03+ ATGGTATGTGTATCATCCTTGTTCTTCATGGCCAAGATGCCACTAGGCACATCATCATTA
                      ____________________________________________________________
consensus ATGGTATGTGTATCATCCTTGTTCTTCATGGCCAAGATGCCACTAGGCACATCATCATTA
 
. : . : . : . : . : . :
JMFS106G03+ GGTATCTGTATTGGTCTCAAAGCTTGACCCCCCAATATCCTTGCACAGCTTAAACATACT
                      ____________________________________________________________
consensus GGTATCTGTATTGGTCTCAAAGCTTGACCCCCCAATATCCTTGCACAGCTTAAACATACT
 
. : . : . : . : . : . :
JMFS106G03+ ATTCCTCCAAGATCCATATATTCAAACAGATATTTTGATGCAATGCACCCGCAGTGAATA
                      ____________________________________________________________
consensus ATTCCTCCAAGATCCATATATTCAAACAGATATTTTGATGCAATGCACCCGCAGTGAATA
 
. : . : . : . : . : . :
JMFS106G03+ CGCTTTCTACACATTCTGCACTCCTTCCAACCAGACTCATCCAGGTGGAACGTTTCACAA
                      ____________________________________________________________
consensus CGCTTTCTACACATTCTGCACTCCTTCCAACCAGACTCATCCAGGTGGAACGTTTCACAA
 
. : . : . : . : . : . :
JMFS106G03+ AAAGCTACCTTTTCGTAAGCAGATCCGCAGCTGTAACAAAGGATAGCAAATCCACCTGAT
JMFS040E09+ GCAAATCCACCTGAT
                      ____________________________________________________________
consensus AAAGCTACCTTTTCGTAAGCAGATCCGCAGCTGTAACAAAGGATAGCAAATCCACCTGAT
 
. : . : . : . : . : . :
JMFS106G03+ TTCAAGCCCCAACCTTTTTTCCATTCAGACGACGTCGTCGAGCAGCAGAGCTCGTTCATG
JMFS040E09+ TTCAAGCCCCAACCTTTCTTCCATTCAGACGACGTCGTCGCACGACACAGCTCGTTCATG
                      ____________________________________________________________
consensus TTCAAGCCCCAACCTTTTTTCCATTCAGACGACGTCGTCGCGCGGCAGAGCTCGTTCATG
 
. : . : . : . : . : . :
JMFS106G03+ CAAACATTTGACCCCATT
JMFS040E09+ CAAAACTTTGACCCCATTTCTCTCACCAAAATCAAACCTTCCAACCCCCCCAAAACACCT
                      ____________________________________________________________
consensus CAAACCTTTGACCCCATTTCTCTCACCAAAATCAAACCTTCCAACCCCCCCAAAACACCT
 
. : . : . : . : . : . :
JMFS040E09+ CCAAACCTCAAAACTCCTCAAATCAAATCAAAACCCTAAATCCCAATCAACAAATCTCTA
JMSF041H17+ CCAATCAACAAATCTNTA
                      ____________________________________________________________
consensus CCAAACCTCAAAACTCCTCAAATCAAATCAAAACCCTAAATCCCAATCAACAAATCTCTA
 
. : . : . : . : . : . :
JMFS040E09+ ACCCAGATCAACAACCAAAAATCCCATATCCAATACCTTAACACACCAATAATCAAACAC
JMSF041H17+ ACCCAGATCAACAACCAAAAATCCCATATCCAATACCTTAACACACCAATAATCAAACAC
                      ____________________________________________________________
consensus ACCCAGATCAACAACCAAAAATCCCATATCCAATACCTTAACACACCAATAATCAAACAC
 
. : . : . : . : . : . :
JMFS040E09+ TAACAACACTTTACAGCTCACCCAGTTCAATCTATCGAATGCAACGTCCACGCAGACCAA
JMSF041H17+ TAACAACACTTTACAGCTCACCCAGTTCAATCTATCGAATGCAACGTCCACGCAGACCAA
                      ____________________________________________________________
consensus TAACAACACTTTACAGCTCACCCAGTTCAATCTATCGAATGCAACGTCCACGCAGACCAA
 
. : . : . : . : . : . :
JMFS040E09+ AAGCAACCCTCATCAACAATCCATCTCCCTGCTATTGCATGAAATCTGAACTGAATCTCA
JMSF041H17+ AAGCAACCCTCATCAACAATCCATCTCCCTGCTATTGCATGAAATCTGAACTGAATCTCA
                      ____________________________________________________________
consensus AAGCAACCCTCATCAACAATCCATCTCCCTGCTATTGCATGAAATCTGAACTGAATCTCA
 
. : . : . : . : . : . :
JMFS040E09+ CGGGTCAAAGCAGCGAAAAACGGCGGCGGTCGGCGGTCGGCGGCGGTCGGTGGTTCTTGG
JMSF041H17+ CGGGTCAAAGCAGCGAAAAACGGCGGCGGTCGGCGGTCGGCGGCGGTCGGTGGTTCTTGG
                      ____________________________________________________________
consensus CGGGTCAAAGCAGCGAAAAACGGCGGCGGTCGGCGGTCGGCGGCGGTCGGTGGTTCTTGG
 
. : . : . : . : . : . :
JMFS040E09+ TAGGGGATAAAGAAGGGTAACGATACAGATCGATTAACCAGTATATTTTTTGTTTAAATT
JMSF041H17+ TAGGGGATAAAGAAGGGTAACGATACAGATCGATTAACCAGTATATTTTTTGTTTAAATT
                      ____________________________________________________________
consensus TAGGGGATAAAGAAGGGTAACGATACAGATCGATTAACCAGTATATTTTTTGTTTAAATT
 
. : . : . : . : . : . :
JMFS040E09+ TAGAGCGAGAAACTACGAGTGTGAATTAGAGAGAGAAAGCGTGTGCATGCAGAGCAAACA
JMSF041H17+ TAGAGCGAGAAACTACGAGTGTGAATTAGAGAGAGAAAGCGTGTGCATGCAGAGCAAACA
                      ____________________________________________________________
consensus TAGAGCGAGAAACTACGAGTGTGAATTAGAGAGAGAAAGCGTGTGCATGCAGAGCAAACA
 
. : . : . : . : . : . :
JMFS040E09+ ACAGGGTAGAGTTAGAGAGAGAAAGCCAAGAAAAAGATAGCCCAAAATG
JMSF041H17+ ACAGGGTAGAGTTAGAGAGAGAAAGCCAAGAAAAAGATAGCCCAAAATGCATGCACGATC
                      ____________________________________________________________
consensus ACAGGGTAGAGTTAGAGAGAGAAAGCCAAGAAAAAGATAGCCCAAAATGCATGCACGATC