Previous Contig 007417:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS047F10Sequence642007417 (6)
JMFS060B08Sequence632007417 (6)
JMFS114G05Sequence549007417 (6)
JMFS141C05Sequence622007417 (6)pir|E84846|E848464e-04probable receptor-like protein kinase [imported] - Arabidopsis thaliana>gb:AC002
JMFS154G12Sequence626007417 (6)
JMSF041G14Sequence533007417 (6)609012862 (3)pir|E84846|E848462e-59probable receptor-like protein kinase [imported] - Arabidopsis thaliana>gb:AC002

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS141C05+ AGCTGCATCCAATCCCATGCCAAGAACAGAAATCTGA
                      ____________________________________________________________
consensus AGCTGCATCCAATCCCATGCCAAGAACAGAAATCTGA
 
. : . : . : . : . : . :
JMFS114G05+ GTTTGAGCCCAACCCTGATACCCCTAGCTCTTTTCCAATGGCTACCAGTATAGTCTG
JMFS141C05+ GGTGTTTGAGCCCCACCCTGATACCCCTAGCTCTTTTCCAATGGCTACCAGTATAGTCTG
                      ____________________________________________________________
consensus GGTGTTTGAGCCCCACCCTGATACCCCTAGCTCTTTTCCAATGGCTACCAGTATAGTCTG
 
. : . : . : . : . : . :
JMFS114G05+ TTCTTGCACAGCTTCACCACTTGTCACCAACCCCACTACCAAAACACTCAACAAGCTCAA
JMFS141C05+ TTCTTGCACAGCTTCACCACTTGTCACCAACCCCACTACCAAAACACTCAACAAGCTCAA
JMFS047F10+ CACCAACCCCACTACCAAAACACTCAACAAGCTCAA
                      ____________________________________________________________
consensus TTCTTGCACAGCTTCACCACTTGTCACCAACCCCACTACCAAAACACTCAACAAGCTCAA
 
. : . : . : . : . : . :
JMFS114G05+ AAATCCCATTTTTAGGTCACTTTCAAGAACCCTCACTCTTCTCATATTTCTTCTCCTCCT
JMFS141C05+ AAATCCCATTTTTAGGTCACTTTCAAGAACCCTCACTCTTCTCATATTTCTTCTCCTCCT
JMFS047F10+ AAATCCCATTTTTAGGTCACTTTCAAGAACCCTCACTCTTCTCATATTTCTTCTCCTCCT
JMFS060B08+ ATCCCATTTTTAGGTCACTTTCAAGAACCCTCACTCTTCTCATATTTCTTCTCCTCCT
JMFS154G12+ GGTCACTTTCAAGAACCCTCACTCTTCTCATATTTCTTCTCCTCCT
                      ____________________________________________________________
consensus AAATCCCATTTTTAGGTCACTTTCAAGAACCCTCACTCTTCTCATATTTCTTCTCCTCCT
 
. : . : . : . : . : . :
JMFS114G05+ CCCCAAATTCCCCCAAATAGAAACACCCAAAGGTACATAAATCAAGAATGTGCAAGACCA
JMFS141C05+ CCCCAAATTCCCCCAAATAGAAACACCCAAAGGTACATAAATCAAGAATGTGCAAGACCA
JMFS047F10+ CCCCAAATTCCCCCAAATAGAAACACCCAAAGGTACATAAATCAAGAATGTGCAAGACCA
JMFS060B08+ CCCCAAATTCCCCCAAATAGAAACACCCAAAGGTACATAAATCAAGAATGTGCAAGACCA
JMFS154G12+ CCCCAAATTCCCCCAAATAGAAACACCCAAAGGTACATAAATCAAGAATGTGCAAGACCA
                      ____________________________________________________________
consensus CCCCAAATTCCCCCAAATAGAAACACCCAAAGGTACATAAATCAAGAATGTGCAAGACCA
 
. : . : . : . : . : . :
JMFS114G05+ CCCAATTTTCTTCTCTTCCTTCTTCAACAGAAACAAGGAAAATGGACCAGAGACCAAAAA
JMFS141C05+ CCCAATTTTCTTCTCTTCCTTCTTCAACAGAAACAAGGAAAATGGACCAGAGACCAAAAA
JMFS047F10+ CCCAATTTTCTTCTCTTCCTTCTTCAACAGAAACAAGGAAAATGGACCAGAGACCAAAAA
JMFS060B08+ CCCAATTTTCTTCTCTTCCTTCTTCAACAGAAACAAGGAAAATGGACCAGAGACCAAAAA
JMFS154G12+ CCCAATTTTCTTCTCTTCCTTCTTCAACAGAAACAAGGAAAATGGACCAGAGACCAAAAA
JMSF041G14+ TTCCTTNTTCAACNGAAACAAGGAAAATGGACCNGAGACCAAAAA
                      ____________________________________________________________
consensus CCCAATTTTCTTCTCTTCCTTCTTCAACAGAAACAAGGAAAATGGACCAGAGACCAAAAA
 
. : . : . : . : . : . :
JMFS114G05+ GACACTTTTTTTGGGGGCAATGGATATTCAAGAACAATGTGAGATTTGGGGGTTACAAAA
JMFS141C05+ GACACTTTTTTTGGGGGCAATGGATATTCAAGAACAATGTGAGATTTGGGGGTTACAAAA
JMFS047F10+ GACACTTTTTTTGGGGGCAATGGATATTCAAGAACAATGTGAGATTTGGGGGTTACAAAA
JMFS060B08+ GACACTTTTTTTGGGGGCAATGGATATTCAAGAACAATGTGAGATTTGGGGGTTACAAAA
JMFS154G12+ GACACTTTTTTTGGGGGCAATGGATATTCAAGAACAATGTGAGATTTGGGGGTTACAAAA
JMSF041G14+ GACNCTTTTTTTGGGGGCAATGGATNTTCAAGAACAATGTGAGATTTGGGGGTTACAAAA
                      ____________________________________________________________
consensus GACACTTTTTTTGGGGGCAATGGATATTCAAGAACAATGTGAGATTTGGGGGTTACAAAA
 
. : . : . : . : . : . :
JMFS114G05+ TAAAGAAATATCTGAGTAGTAACCGATAGAATGATGAAAAAGAGTGGTACCGAGAGCGCC
JMFS141C05+ TAAAGAAATATCTGAGTAGTAACCGATAGAATGATGAAAAAGAGTGGTACCGAGAGCGCC
JMFS047F10+ TAAAGAAATATCTGAGTAGTAACCGATAGAATGATGAAAAAGAGTGGTACCGAGAGCGCC
JMFS060B08+ TAAAGAAATATCTGAGTAGTAACCGATAGAATGATGAAAAAGAGTGGTACCGAGAGCGCC
JMFS154G12+ TAAAGAAATATCTGAGTAGTAACCGATAGAATGATGAAAAAGAGTGGTACCGAGAGCGCC
JMSF041G14+ TAAAGAAATNTNTGAGTNGTAACCGATAGAATGATGAAAAAGAGTGGTACCGAGAGCGCC
                      ____________________________________________________________
consensus TAAAGAAATATCTGAGTAGTAACCGATAGAATGATGAAAAAGAGTGGTACCGAGAGCGCC
 
. : . : . : . : . : . :
JMFS114G05+ AAAAACAAAACACTAGCAAAGAGAAACCAACCCAGAAAACCCGGTGCAGAGATTAAGGAT
JMFS141C05+ AAAAACAAAACACTAGCAAAGAGAAACCAACCCAGAAAACCCGGTGCAGAGATTAAGGAT
JMFS047F10+ AAAAACAAAACACTAGCAAAGAGAAACCAACCCAGAAAACCCGGTGCAGAGATTAAGGAT
JMFS060B08+ AAAAACAAAACACTAGCAAAGAGAAACCAACCCAGAAAACCCGGTGCAGAGATTAAGGAT
JMFS154G12+ AAAAACAAAACACTAGCAAAGAGAAACCAACCCAGAAAACCCGGTGCAGAGATTAAGGAT
JMSF041G14+ AAAAACAAAACNCCAGCAAAGNGAAACCAACCCNGAAAACCCGGTGCAGAGATTAAGGAT
                      ____________________________________________________________
consensus AAAAACAAAACACTAGCAAAGAGAAACCAACCCAGAAAACCCGGTGCAGAGATTAAGGAT
 
. : . : . : . : . : . :
JMFS114G05+ AAAACGGATTATGATAACATGAAGATGAGCAGAAGCACGAGTGCATGACCATGAACAGGA
JMFS141C05+ AAAACGGATTATGATAACATGAAGATGAGCAGAAGCACGAGTGCATGACCATGAACAGGA
JMFS047F10+ AAAACGGATTATGATAACATGAAGATGAGCAGAAGCACGAGTGCATGACCATGAACAGGA
JMFS060B08+ AAAACGGATTATGATAACATGAAGATGAGCAGAAGCACGAGTGCATGACCATGAACAGGA
JMFS154G12+ AAAACGGATTATGATAACATGAAGATGAGCAGAAGCACGAGTGCATGACCATGAACAGGA
JMSF041G14+ AAAACGGATTNTGATAACNTGAAGATGAGCNGAAGCNCGAGTGCATGACCNTGAACNGGA
                      ____________________________________________________________
consensus AAAACGGATTATGATAACATGAAGATGAGCAGAAGCACGAGTGCATGACCATGAACAGGA
 
. : . : . : . : . : . :
JMFS114G05+ AGTTCTGCAGAG
JMFS141C05+ AGTTCTGCAGAGAAAAAAAAAATCTAAAACAATAATTTAATGTTG
JMFS047F10+ AGTTCTGCAGAGAAAAAAAAAATCTAAAACAATAATTTAATGTTGCAGGGGAAAAAGAAC
JMFS060B08+ AGTTCTGCAGAGAAAAAAAAAATCTAAAACAATAATTTAATGTTGCAGGGGAAAAAGAAC
JMFS154G12+ AGTTCTGCAGAGAAAAAAAAAATCTAAAACAATAATTTAATGTTGCAGGGGAAAAAGAAC
JMSF041G14+ AGTTNTGCAGAGAAAAAAAAAATCTAAAACAATAATTTAATGTTGCAGGGGAAAAAGAAC
                      ____________________________________________________________
consensus AGTTCTGCAGAGAAAAAAAAAATCTAAAACAATAATTTAATGTTGCAGGGGAAAAAGAAC
 
. : . : . : . : . : . :
JMFS047F10+ AATGGAATGTAGCAGTTTCTTGGAACAAACATGAGTGACGAAACAAGGGGGGAGGGGAAA
JMFS060B08+ AATGGAATGTAGCAGTTTCTTGGAACAAACATGAGTGACGAAACAAGGGGGGAGGGGAAA
JMFS154G12+ AATGGAATGTAGCAGTTTCTTGGAACAAACATGAGTGACGAAACAAGGGGGGAGGGGAAA
JMSF041G14+ AATGGAATGTAGCAGTTTCTTGGAACAAACATGAGTGACGAAACAAGGGGGGAGGGGAAA
                      ____________________________________________________________
consensus AATGGAATGTAGCAGTTTCTTGGAACAAACATGAGTGACGAAACAAGGGGGGAGGGGAAA
 
. : . : . : . : . : . :
JMFS047F10+ TGGGTACAATGTTGTTGTTTGGGCAAACTGCTTTCACGGGTCAGGTGTTTTCCCTCTCTG
JMFS060B08+ TGGGTACAATGTTGTTGTTTGGGCAAACTGCTTTCACGGGTCAGGTGTTTTCCCTCTCTG
JMFS154G12+ TGGGTACAATGTTGTTGTTTGGGCAAACTGCTTTCACGGGTCAGGTGTTTTCCCTCTCTG
JMSF041G14+ TGGGTACAATGTTGTTGTTTGGGCAAACTGCTTTCACGGGTCAGGTGTTTTCCCTCTCTG
                      ____________________________________________________________
consensus TGGGTACAATGTTGTTGTTTGGGCAAACTGCTTTCACGGGTCAGGTGTTTTCCCTCTCTG
 
. : . : . : . : . : . :
JMFS047F10+ TCCTAG
JMFS060B08+ TCCTAGAGCGAGAAAGAGAATGAGAGAGAGAAAG
JMFS154G12+ TCCTAGAGCGAGAAAGAGAATGAGAGAGAGAAAG
JMSF041G14+ TCCTAGAGCGAGAAAGAGAATGAGAGAGAGAAAGAGAGGGGATAATGGCAGTACACGCCC
                      ____________________________________________________________
consensus TCCTAGAGCGAGAAAGAGAATGAGAGAGAGAAAGAGAGGGGATAATGGCAGTACACGCCC