Previous Contig 007412:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005J08Sequence449007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.500007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMFF011N10Sequence519007412 (19)gb:AY389648_11782721e-33Hyacinthus orientalis histone H4 mRNA, complete cds.503007412 (19)gb:AY389648_11782723e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMFF034H06Sequence426007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.490007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMFF038N04Sequence393007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.497007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMFN013P05Sequence502007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMFN028M06Sequence476007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMFN029A17Sequence503007412 (19)gb:AY389648_11782723e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMFN045J03Sequence469007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMFN045J05Sequence473007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMFN045O23Sequence509007412 (19)gb:AY389648_11782723e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMFS044H02Sequence520007412 (19)gb:SRH41_17224023e-34S.rostrata mRNA coding for Histone H4 homologue.
JMFS066H05Sequence498007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMSF018J09Sequence541001807 (126)gb:AY085669_15707366e-75Arabidopsis thaliana clone 16846 mRNA, complete sequence.471007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.
JMSF041F10Sequence522007412 (19)gb:AY389648_11782723e-39Hyacinthus orientalis histone H4 mRNA, complete cds.472007412 (19)gb:AY389648_11782722e-39Hyacinthus orientalis histone H4 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN045J05+ TTCATAAGAACTGAAATTCATATGATTAATATCAGAGTCACAT
JMFN045O23+ GAGAATTCATAAGAACTGAAATTCATATGATTAATATCAGAGTCACAT
JMFF011N10+ TCATAAGAACTGAAATTCATATGATTAATATCAGAGTCACAT
JMFS066H05+ CATAAGAACTGAAATTCATATGATTAATATCAGAGTCACAT
JMFN013P05+ CATAAGAACTGAAATTCATATGATTAATATCAGAGTCACAT
rJMFF038N04- TATGATTAATATCAGAGTCACAT
rJMFF005J08- TATGATTAATATCAGAGTCACAT
rJMFF034H06- TATCAGAGTCACAT
rJMFF011N10- TATGATTAATATCAGAGTCACAT
JMFN045J03+ CATAAGAACTGAAATTCATATGATTAATATCAGAGTCACAT
JMSF041F10+ TTCATAAGAANTGAAATTCATATGATTAATATCAGAGTCACAT
                      ____________________________________________________________
consensus GAGAATTCATAAGAACTGAAATTCATATGATTAATATCAGAGTCACAT
 
. : . : . : . : . : . :
JMFN045J05+ TGTAACAATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
JMFN045O23+ TGTAACAATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
JMFF011N10+ TGTAACAATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
JMFS066H05+ TGTAACAATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
JMFN028M06+ ATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
JMFS044H02+ ATCAATCTGAGATTGATTCAGATCAGGACGCCCAATTTACCCGTAATCATCAA
JMFN013P05+ TGTAACAATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
rJMFF038N04- TGTAACAATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
rJMFF005J08- TGTAACAATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
rJMFF034H06- TGTAACAATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
rJMFF011N10- TGTAACAATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
rJMSF018J09- AATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
JMFN045J03+ TGTAACAATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
rJMSF041F10- ATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
JMFF005J08+ TCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
JMFF034H06+ TAATCATCAA
JMSF041F10+ NGTAACAATCAATNTGAGATTGATTCAGAACAGAACGCCCAATTTAACCNTAATCATCAA
                      ____________________________________________________________
consensus TGTAACAATCAATCTGAGATTGATTCAGAACAGAACGCCCAATTTAACCCTAATCATCAA
 
. : . : . : . : . : . :
JMFN045J05+ CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
JMFN045O23+ CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
JMFF011N10+ CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
JMFS066H05+ CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
JMFN028M06+ CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
JMFS044H02+ CCATAGATCTATACACCACCGAAATATACACCGCCGATATCAAATCCTAACCGCTGAATC
JMFN013P05+ CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
rJMFF038N04- CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
rJMFF005J08- CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
rJMFF034H06- CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
rJMFF011N10- CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
rJMSF018J09- CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
JMFN045J03+ CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
rJMSF041F10- CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
JMFN029A17+ CCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
JMFF005J08+ CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
JMFF034H06+ CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
JMFF038N04+ GAAATATACACCGCCGATATCAAAACNTAACCGCCGAATC
JMSF041F10+ CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
                      ____________________________________________________________
consensus CCCTAGATCTAAACACCACCGAAATATACACCGCCGATATCAAAACCTAACCGCCGAATC
 
. : . : . : . : . : . :
JMFN045J05+ CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
JMFN045O23+ CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
JMFF011N10+ CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
JMFS066H05+ CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
JMFN028M06+ CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
JMFS044H02+ CGTACAGAGTGCGGCCCTGTCTCTTGATAGCATAGAAGACGTCCAGTGCGGTGGCCGTCT
JMFN013P05+ CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
rJMFF038N04- CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
rJMFF005J08- CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
rJMFF034H06- CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
rJMFF011N10- CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
rJMSF018J09- CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
JMFN045J03+ CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
rJMSF041F10- CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
JMFN029A17+ CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
JMFF005J08+ CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
JMFF034H06+ CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
JMFF038N04+ CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
JMSF041F10+ CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
                      ____________________________________________________________
consensus CGTACAGAGTGCGGCCCTGTCTCTTGAGAGCATAGACGACGTCCATTGCGGTGACCGTCT
 
. : . : . : . : . : . :
JMFN045J05+ TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
JMFN045O23+ TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
JMFF011N10+ TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGCGGGATGACGTTCTCGAGGAAGATC
JMFS066H05+ TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
JMFN028M06+ TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
JMFS044H02+ TCCGGCGAGCGTGATCAGTGTAGGTAACAGCGTCGC-GGATAACGTTCTCTAGCAAGATC
JMFN013P05+ TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
rJMFF038N04- TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
rJMFF005J08- TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
rJMFF034H06- TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
rJMFF011N10- TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
rJMSF018J09- TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
JMFN045J03+ TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
rJMSF041F10- TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
JMFN029A17+ TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
JMFF005J08+ TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
JMFF034H06+ TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
JMFF038N04+ TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
JMSF041F10+ TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
                      ____________________________________________________________
consensus TCCGGCGAGCGTGCTCAGTGTAGGTAACAGCGTCGC-GGATGACGTTCTCGAGGAAGATC
 
. : . : . : . : . : . :
JMFN045J05+ TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
JMFN045O23+ TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
JMFF011N10+ TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
JMFS066H05+ TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
JMFN028M06+ TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
JMFS044H02+ TTGAGGACGCCGCGAGTCTCGTCGTAGATGAGGCCGAAGATACGTTTCACTCCACCACGA
JMFN013P05+ TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
rJMFF038N04- TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
rJMFF005J08- TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
rJMFF034H06- TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
rJMFF011N10- TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
rJMSF018J09- TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
JMFN045J03+ TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
rJMSF041F10- TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
JMFN029A17+ TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
JMFF005J08+ TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
JMFF034H06+ TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
JMFF038N04+ TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
JMSF041F10+ TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
                      ____________________________________________________________
consensus TTGAGGACGCCGCGAGTCTCCTCGTAGATGAGGCCGGAGATACGCTTCACTCCACCACGG
 
. : . : . : . : . : . :
JMFN045J05+ CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
JMFN045O23+ CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
JMFF011N10+ CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
JMFS066H05+ CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
JMFN028M06+ CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
JMFS044H02+ GGAGCAAGACGGCGAATGGCCGGTTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTAG
JMFN013P05+ CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
rJMFF038N04- CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
rJMFF005J08- CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
rJMFF034H06- CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
rJMFF011N10- CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
rJMSF018J09- CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
JMFN045J03+ CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
rJMSF041F10- CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
JMFN029A17+ CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
JMFF005J08+ CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
JMFF034H06+ CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
JMFF038N04+ CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
JMSF041F10+ CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
                      ____________________________________________________________
consensus CGAGCAAGACGGCGAATGGCCGGCTTCGTGATGCCTTGGATGTTGTCCCGGAGGACCTTA
 
. : . : . : . : . : . :
JMFN045J05+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
JMFN045O23+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
JMFF011N10+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
JMFS066H05+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
JMFN028M06+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
JMFS044H02+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCC
JMFN013P05+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
rJMFF038N04- CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
rJMFF005J08- CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
rJMFF034H06- CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
rJMFF011N10- CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
rJMSF018J09- CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
JMFN045J03+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
rJMSF041F10- CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
JMFN029A17+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
JMFF005J08+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
JMFF034H06+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
JMFF038N04+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
JMSF041F10+ CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
                      ____________________________________________________________
consensus CGGTGTCGTTTCGCTCCTCCCTTTCCCAAACCCTTACCGCCCTTTCCACGCCCAGACATT
 
. : . : . : . : . : . :
JMFN045J05+ TTCAGCAA
JMFN045O23+ TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTG
JMFF011N10+ TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTGTCTTTTGATCACGCT
JMFS066H05+ TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGA
JMFN013P05+ TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTG
rJMFF038N04- TTCAGCAAATTCTTCTCTTCNTCGCTAAGGAAATCTGACCTGTCTTTTGATCAC
rJMFF005J08- TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTGTCTTTTGATCAC
rJMFF034H06- TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTGTCTTTTGATCACGCT
rJMFF011N10- TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTGTCTTTTGATCACGCT
rJMSF018J09- TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTGTCTTTTGATCACGCT
JMFN045J03+ TTCAGCAAA
rJMSF041F10- TTCAGNAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTGTCTTTTGATCACGCT
JMFN029A17+ TTCAGCAAATTCTTCTCTTCT
JMFF005J08+ TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTGTCTTTTGATCAC
JMFF034H06+ TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTGTCTTTTGATCACGCT
JMFF038N04+ TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTGTCTTTTGATCAC
JMSF041F10+ TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTGTCTTTTGATCACGCTGTC
                      ____________________________________________________________
consensus TTCAGCAAATTCTTCTCTTCTTCGCTAAGGAAATCTGACCTGTCTTTTGATCACGCTGTC