Previous Contig 007397:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF041D14Sequence597007397 (2)pir|T02101|T021012e-05hypothetical protein At2g41180 [imported] - Arabidopsis thaliana>gb:AC004261_153552007397 (2)pir|T02101|T021012e-05hypothetical protein At2g41180 [imported] - Arabidopsis thaliana>gb:AC004261_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041D14+ GGATCTCCATTTTCTTGTGACGAAGAAAAACCATTTTTCTCTTTGGAAGATCGCAAA
JMSF041D14- GGATCTCCATTTTCTTGTGACGAAGAAAAACCATTTTTCTCTTTGGAAGATCGCAAA
                      ____________________________________________________________
consensus GGATCTCCATTTTCTTGTGACGAAGAAAAACCATTTTTCTCTTTGGAAGATCGCAAA
 
. : . : . : . : . : . :
rJMSF041D14+ ACCCTTCGCAGATTTCCGGGCGGTTTTCCGGTTCGCAGATAACTGTTTTTGATGGAGAAA
JMSF041D14- ACCCTTCGCAGATTTCCGGGCGGTTTTCCGGTTCGCAGATAACTGTTTTTGATGGAGAAA
                      ____________________________________________________________
consensus ACCCTTCGCAGATTTCCGGGCGGTTTTCCGGTTCGCAGATAACTGTTTTTGATGGAGAAA
 
. : . : . : . : . : . :
rJMSF041D14+ ACGCTGAGCGCGCAGCCGCCGCCGCAGAAGAAGAAGAAAGCTTTGAAGCAGCCGAAAGCG
JMSF041D14- ACGCTGAGCGCGCAGCCGCCGCCGCAGAAGAAGAAGAAAGCTTTGAAGCAGCCGAAAGCG
                      ____________________________________________________________
consensus ACGCTGAGCGCGCAGCCGCCGCCGCAGAAGAAGAAGAAAGCTTTGAAGCAGCCGAAAGCG
 
. : . : . : . : . : . :
rJMSF041D14+ GCGGCGAACGCCGCCGCCAGGAAGCGGCTGAAGGTGGTGTACATCTCAAACCCGATGAAA
JMSF041D14- GCGGCGAACGCCGCCGCCAGGAAGCGGCTGAAGGTGGTGTACATCTCAAACCCGATGAAA
                      ____________________________________________________________
consensus GCGGCGAACGCCGCCGCCAGGAAGCGGCTGAAGGTGGTGTACATCTCAAACCCGATGAAA
 
. : . : . : . : . : . :
rJMSF041D14+ GTGGAGACGAGTCCGTCGGAATTTAGGGCTTTGGTGCAGGAACTGACCGGCCAGGACGCC
JMSF041D14- GTGGAGACGAGTCCGTCGGAATTTAGGGCTTTGGTGCAGGAACTGACCGGCCAGGACGCC
                      ____________________________________________________________
consensus GTGGAGACGAGTCCGTCGGAATTTAGGGCTTTGGTGCAGGAACTGACCGGCCAGGACGCC
 
. : . : . : . : . : . :
rJMSF041D14+ GACGTCCCGGGCCCGCCGTTCAAGTTCCCGGGGAGCCCCGGTGTCGGTGCCGGCGGCGGG
JMSF041D14- GACGTCCCGGGCCCGCCGTTCAAGTTCCCGGGGAGCCCCGGTGTCGGTGCCGGCGGCGGG
                      ____________________________________________________________
consensus GACGTCCCGGGCCCGCCGTTCAAGTTCCCGGGGAGCCCCGGTGTCGGTGCCGGCGGCGGG
 
. : . : . : . : . : . :
rJMSF041D14+ ATGCAGCTGGTGGTTCCGGACGGGAACAAGGTCTCGGCGGAAGAACATTCCGGCGAGGCG
JMSF041D14- ATGCAGCTGGTGGTTCCGGACGGGAACAAGGTCTCGGCGGAAGAACATTCCGGCGAGGCG
                      ____________________________________________________________
consensus ATGCAGCTGGTGGTTCCGGACGGGAACAAGGTCTCGGCGGAAGAACATTCCGGCGAGGCG
 
. : . : . : . : . : . :
rJMSF041D14+ GGGGTGCAGCATGGGAGCAGCGACGTGCCGGAGAGCTCAGATCTCTCGTCGGAGACGGCG
JMSF041D14- GGGGTGCAGCATGGGAGCAGCGACGTGCCGGAGAGCTCAGATCTCTCGTCGGAGACGGCG
                      ____________________________________________________________
consensus GGGGTGCAGCATGGGAGCAGCGACGTGCCGGAGAGCTCAGATCTCTCGTCGGAGACGGCG
 
. : . : . : . : . : . :
rJMSF041D14+ CCGGATTACCTGCCGCAGTTGATAGAGGATTTTCCGGGGATAATGCCTTCAAACATGTGG
JMSF041D14- CCGGATTACCTGCCGCAGTTGATAGAGGATTTTCCGGGGATAATGCCTTCAAACATGTGG
                      ____________________________________________________________
consensus CCGGATTACCTGCCGCAGTTGATAGAGGATTTTCCGGGGATAATGCCTTCAAACATGTGG
 
. : . : . : . : . : . :
rJMSF041D14+ TATGA-TGAACGTACT
JMSF041D14- TATGATTGAACGTACTGAATGTGATGAAGTTAATTGCGTAATTTATCGGCAAAAAAAAAA
                      ____________________________________________________________
consensus TATGATTGAACGTACTGAATGTGATGAAGTTAATTGCGTAATTTATCGGCAAAAAAAAAA