Previous Contig 007394:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003O18Sequence564007394 (11)gb:AB125886_15282284e-79Ipomoea batatas SRF7 mRNA for putative UDP-glucosyl transferase, partial cds.
JMFF009L09Sequence562007394 (11)gb:AB125886_15282282e-72Ipomoea batatas SRF7 mRNA for putative UDP-glucosyl transferase, partial cds.750007394 (11)gb:AF303396_17843466e-68Phaseolus vulgaris UDP-glucosyltransferase HRA25 mRNA, complete cds.
JMSF008B10Sequence187007394 (11)gb:AB125886_15282283e-17Ipomoea batatas SRF7 mRNA for putative UDP-glucosyl transferase, partial cds.791007394 (11)gb:AF303396_17843463e-62Phaseolus vulgaris UDP-glucosyltransferase HRA25 mRNA, complete cds.
JMSF034O22Sequence665007394 (11)gb:AB125886_15282281e-63Ipomoea batatas SRF7 mRNA for putative UDP-glucosyl transferase, partial cds.696007394 (11)gb:AF303396_17843464e-68Phaseolus vulgaris UDP-glucosyltransferase HRA25 mRNA, complete cds.
JMSF041C14Sequence771007394 (11)gb:AB125886_15282281e-76Ipomoea batatas SRF7 mRNA for putative UDP-glucosyl transferase, partial cds.696007394 (11)gb:AF303396_17843461e-60Phaseolus vulgaris UDP-glucosyltransferase HRA25 mRNA, complete cds.
JMSF045F12Sequence787007394 (11)gb:AB125886_15282285e-73Ipomoea batatas SRF7 mRNA for putative UDP-glucosyl transferase, partial cds.778007394 (11)gb:AF303396_17843467e-73Phaseolus vulgaris UDP-glucosyltransferase HRA25 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF008B10- AAATATGGAGATGGAGTAGTTTCAGTCCA
                      ____________________________________________________________
consensus AAATATGGAGATGGAGTAGTTTCAGTCCA
 
. : . : . : . : . : . :
rJMSF008B10- TCATCAGTCTCTATTGGATACAGGTAAAGGGAACAAGTAATTTATGAAACATTTTTAGGT
                      ____________________________________________________________
consensus TCATCAGTCTCTATTGGATACAGGTAAAGGGAACAAGTAATTTATGAAACATTTTTAGGT
 
. : . : . : . : . : . :
rJMSF008B10- TTCATTTAAGGAACAGAAGTGCAATACATAATGTGGCTTGACTGTTTATTATCTCTGAAT
                      ____________________________________________________________
consensus TTCATTTAAGGAACAGAAGTGCAATACATAATGTGGCTTGACTGTTTATTATCTCTGAAT
 
. : . : . : . : . : . :
rJMSF008B10- CAAGCACTTTTGACCGACAGTAGAGATTTGCTTAATTTCTTGCCTTAATCCAGTTAACGA
rJMSF034O22- CAGTTTTGACGGACAGTAGAGATTTGCTTAATTTGTTGCCTTAATCCAGTTAACGA
rJMFF009L09- AGAGATTTGTTTAATTTTTTGCCTTAATCCAGTTAACGA
rJMSF041C14- AGAGATTTGCTTAATTTATTGCCTTAATCCATTTAACGA
rJMSF045F12- CAGTTTTGACGGACAGTAGAGATTTGCTTAATTTGTTGCCTTAATCCAGTTAACGA
                      ____________________________________________________________
consensus CAAGCAGTTTTGACGGACAGTAGAGATTTGCTTAATTTGTTGCCTTAATCCAGTTAACGA
 
. : . : . : . : . : . :
rJMSF008B10- AACTACTGAAATTCCTATACGAAGAACCTCCTCTTTTAACACTAGACAACACCTCTGCTT
rJMSF034O22- AACTACTGAAATTCCTATACGAAGACCCTCCTCTTTTAACACTAGACACCACCTCTGCTT
rJMFF009L09- AACTACTGAAATTTCGATACGAAGACCCTCCACTTTTAACACTGGGCACCACCTCTGCTT
rJMSF041C14- AACTACTGAAATTCCGATACGAAGACCCTCCTATTTTAACACTAGACACCACCTTTGCTT
rJMSF045F12- AACTACTGAAATTCCTATACGAAGACCCTCCTCTTTTAACACTAGACACCACCTCTGCTT
                      ____________________________________________________________
consensus AACTACTGAAATTCCTATACGAAGACCCTCCTCTTTTAACACTAGACACCACCTCTGCTT
 
. : . : . : . : . : . :
rJMSF008B10- GAAGATCTACGGATCTAGCTTTGAAGTTTTCATCCCCAAACAATTGTTCCACCTTGTTCT
rJMSF034O22- GAAGATCCACGGCTCTAGCTTTGAAGTTTTCATCCCCAAACAATTGTTCCACCTTGTTCT
rJMFF009L09- GAAGATCCACGGCTCTAGCTTTGAAGTTCTCATCCCCAAACAATTGTTCCACCTTGTTCC
rJMSF041C14- GAAGATCCACGGCTCTAGTTTTGAAGTTTTCATCCCCAAACAATTGTTCCACCTTGTTCT
rJMSF045F12- GAAGATCCACGGCTCTAGCTTTGAAGTTTTCATCCCCAAACAATTGTTCCACCTTGTTCT
                      ____________________________________________________________
consensus GAAGATCCACGGCTCTAGCTTTGAAGTTTTCATCCCCAAACAATTGTTCCACCTTGTTCT
 
. : . : . : . : . : . :
rJMSF008B10- TTATTTCCCGTCGTCCGATGATTCCATTATTGTTTCTATCGAACCCCAAACCAATCTTCC
rJMSF034O22- TGATTTCCCGTCGTCCGATGATTCCATTCTCGTTTCTATCGAACCCCAAACCAATCTTCC
rJMFF009L09- TAATTTCATGTCGTCCGATGACTCCACACTCATTTCTATGGAACGCTAAACTAATCTTCC
rJMSF041C14- TGATTTCCTGTC---------------TCTCATTTCTATCGAACCCCAAACCAACCTTCC
rJMSF045F12- TGATTTCCCGTCGTCCGATGATTCCATTCTCGTTTCTATCGAACCCCAAACCAATCTTCC
                      ____________________________________________________________
consensus TGATTTCCCGTCGTCCGATGATTCCATTCTCGTTTCTATCGAACCCCAAACCAATCTTCC
 
. : . : . : . : . : . :
rJMSF008B10- AAACATCACAGATGTAACTTTTGTTGAATAACTGATCAGCAAAGTATGGCCAGCACAAGA
rJMSF034O22- AAACATCACATATGTAACTTTTGTTGAATAACTGATCAGCAAAGTATGGCCAGCACAAGA
rJMFF009L09- AAACATCACAGATGTAACTTTTGTTGAATAACTGATCAGCAAAGTATGGCCAGCACAAGA
rJMSF041C14- AAACATCACATATGTAACTTTTGTTGAATATCTGATCACCAAAGTATGGCCAGCACAAGA
rJMSF045F12- AAACATCACATATGTAACTTTTGTTGAATAACTGATCAGCAAAGTATGGCCAGCACAAGA
                      ____________________________________________________________
consensus AAACATCACATATGTAACTTTTGTTGAATAACTGATCAGCAAAGTATGGCCAGCACAAGA
 
. : . : . : . : . : . :
rJMSF008B10- AAGGCAAGCCATTGCTGACACCTTCAATGGTAGAATTCCAGCCGCAATGGCTGAGGAAAC
rJMSF034O22- AAGGCAAGCCATTGCTGACACCTTCAATTGTAGAATTCCAGCCGCAATGGCTTAGGAAAC
rJMFF009L09- AAGGCAAGCCATTGCTGACACCTTCAATGGTAGAATTCCAGCCGCAATGGCTGAGGAAAC
rJMSF041C14- AAGGCAAGCCATTGCTGACACCCTCAATGGTGGAATTCCAGCCGCAATGGCTGAGGAAAC
rJMSF045F12- AAGGCAAGCCATTGCTGACACCTTCAATTGTAGAATTCCAGCCGCAATGGCTTAGGAAAC
                      ____________________________________________________________
consensus AAGGCAAGCCATTGCTGACACCTTCAATGGTAGAATTCCAGCCGCAATGGCTGAGGAAAC
 
. : . : . : . : . : . :
rJMSF008B10- AGCCGAGAGAGGGATGCGCCAACACTTTCTGCTGAGGTGCCCATTCAACTAGCCGCCCAC
rJMSF034O22- AGCCGAGAGAGGGATGCGCCAACACTTTCTGCTGAGGTGCCCATTCAACCAGCCGCCCAC
rJMFF009L09- AGCCGAGAGAGGGATGCGCCAACACTTTCTGCTGAGGTGCCCATTCAACTAGCCGCCCAC
rJMSF041C14- AGCCGAGAGAGGGATGCGCCAACACTTTCTGCTGAGGCGCCCATTCAACTAGCAGCCCAC
rJMSF045F12- AGCCGAGAGAGGGATGCGCCAACACTTTCTGCTGAGGTGCCCATTCAACCAGCCGCCCAC
                      ____________________________________________________________
consensus AGCCGAGAGAGGGATGCGCCAACACTTTCTGCTGAGGTGCCCATTCAACTAGCCGCCCAC
 
. : . : . : . : . : . :
rJMSF008B10- GATTGCGGGTTCTGTTTATGAACCCTTCAGGGTAAGCAATTTCCGATTCCTCAATAAACC
rJMSF034O22- GATTGCGGGTTCTGTCTATGAACCCTTCAGGGTAAGGATTTCCTGCTTCCTCAATAAACC
rJMFF009L09- GATTGCAGGTTCTGTCTATGAACCCTTCAGGGTAAGCATTTCCTCCCTCCTCAATAAACC
rJMSF041C14- GATTGCAGGTTCTGTCTATGAACCCTTCAGGGTAAGGATTTCCTTCCTCCTCGATAAACC
rJMSF045F12- GATTGCGGGTTCTGTCTATGAACCCTTCAGGGTAAGGATTTCCTGCTTCCTCAATAAACC
                      ____________________________________________________________
consensus GATTGCGGGTTCTGTCTATGAACCCTTCAGGGTAAGGATTTCCTGCTTCCTCAATAAACC
 
. : . : . : . : . : . :
rJMSF008B10- CTTGCCTAACCACCCATAAAAATGGTCTGTTTGTGAGTTCAAGCCCAAGGGCAAGTTCTT
rJMSF034O22- CTTGCCTAACAACCCATAAAAATGGTCGGTTGGTGAGTTCAAGCCCAAGGGCAAGTTCTT
rJMFF009L09- CTTGCCTAACAACCCATAAAAATGGCCTGTTGGTGAGTTCAAGCCCAAGGGCAAGTTCTT
rJMSF041C14- CTTGCCTAACAACCCATAAAAATGGTCTGTTGGTGAGTTCAAGCCCAAGGGCAAGTTCTT
rJMSF045F12- CTTGCCTAACAACCCATAAAAATGGTCGGTTGGTGAGTTCAAGCCCAAGGGCAAGTTCTT
                      ____________________________________________________________
consensus CTTGCCTAACAACCCATAAAAATGGTCTGTTGGTGAGTTCAAGCCCAAGGGCAAGTTCTT
 
. : . : . : . : . : . :
rJMSF008B10- GAAACTCTGCTATGTCGAAAAATGGTGTGGCTTCCGAATGCAACGTAGATGACTGAGTTG
rJMSF034O22- GAAACTCTGCCATGTTG-AAAATGGTATGGCTTCCGAATGCNACGTAGATGACAGAGTTC
rJMFF009L09- GAAACTCTGCCATGTTG-AAAATGGTGTGGCTTCCAAATGCAACGTAGATGACTGAGTTG
rJMSF041C14- GAAACTCGGCCAAGTTG-AAAATGGTGTGGCTTCCGAATGCAACATAGATGACAGAGTTG
rJMSF045F12- GAAACTCTGCCATGTTG-AAAATGGTATGGCTTCCGAATGCAACGTAGATGACAGAGTTC
                      ____________________________________________________________
consensus GAAACTCTGCCATGTTG-AAAATGGTGTGGCTTCCGAATGCAACGTAGATGACAGAGTTG
 
. : . : . : . : . : . :
rJMSF008B10- AGTGGCTGCTGGTCAAGCCATTTCAGGCAATCGGTGTCCTC
rJMSF034O22- AGTGGCTGCTGGTCAAGCCATTTCAGGCAATCTGTGTCCTCTCGCCAGAAGTGGCCTGAT
rJMFF009L09- AGTGGCTGCTGGTTAAGCCATTTCAGGCAATCTGTGTCCTCTCGCCAAAAGTGGCCCGAT
rJMSF041C14- AGTGGCTGCTGGTCAAGCCATTTCAGGCAATCTGTGTCCTCCCGCCAGAAGTGGCCTGAT
rJMSF045F12- AGTGGCTGCTGGTCAAGCCATTTCAGGCAATCTGTGTCCTCTCGCCAGAAGTGGCCTGAT
JMSF045F12+ TCTCGCCAGAAGTGGCCTGAT
                      ____________________________________________________________
consensus AGTGGCTGCTGGTCAAGCCATTTCAGGCAATCTGTGTCCTCTCGCCAGAAGTGGCCTGAT
 
. : . : . : . : . : . :
rJMSF034O22- GTTT
rJMFF009L09- GTTTCCCCAAGACGGTTGCTTGCTAGTAATGGTCCAATAGGTATCA
rJMSF041C14- GTTT
rJMSF045F12- GTTTTCCCAAGACGATTGCTTGCTAGTAATGGTCCAATAGGTATCATATTCGGATAAAAT
JMSF045F12+ GTTTTCCCAAGACGATTGCTTGCTAGTAATGGTCCAATAGGTATCATATTCGGATAAAAT
JMSF041C14+ AGACGGTTGCATGCTAGTAATGGTCCTATAGGTATGAGCTTCGGGTACGAT
                      ____________________________________________________________
consensus GTTTTCCCAAGACGGTTGCTTGCTAGTAATGGTCCAATAGGTATCATATTCGGATAAAAT
 
. : . : . : . : . : . :
rJMSF045F12- GCAAATACCTCATATTCCATCA
JMSF045F12+ GCAAATACCTCATATTCCATCACCTGAGATGAGTTGCAGAGTAGCCACTCTGCTGCTTTC
JMSF041C14+ GCAAACGTCTCATATTCCATCACCTGAGATGAGTTGCAGATTATCCATTCTGCTGATTTC
                      ____________________________________________________________
consensus GCAAATACCTCATATTCCATCACCTGAGATGAGTTGCAGATTATCCATTCTGCTGCTTTC
 
. : . : . : . : . : . :
JMSF045F12+ ACTGATTCATTGATTTTGAACGCCACATCGAAATGAAGCCTCTGTTGCCCCGGATCGCTG
JMSF041C14+ ACTGATTCATTGTTTTTTACCGCCAGGTCGAAAATAAGCCTCTGTAGCCTTGGATCGCTG
                      ____________________________________________________________
consensus ACTGATTCATTGTTTTTTACCGCCAGGTCGAAATTAAGCCTCTGTTGCCTTGGATCGCTG
 
. : . : . : . : . : . :
JMSF045F12+ AAACAGTTCCACGCTAAATCTGTAGTGTTCATAGCCGGCATTCGAGGCAACAATTTGATG
JMFF003O18+ GTTCATAGCGGGCATAAGAGGCAGCAATTTTATG
JMSF041C14+ AAACAGTTCCACAGTAAATCTGTGGAGTTCATAGCCGGCATGAGAGGCAACAATTTGATG
                      ____________________________________________________________
consensus AAACAGTTCCACGGTAAATCTGTGGTGTTCATAGCCGGCATTAGAGGCAACAATTTGATG
 
. : . : . : . : . : . :
JMSF034O22+ CCATTCTTGCCAACAACCCCATCATCAAGTAGCTTTGGA
JMSF045F12+ CTCTGCTTTCTCAGTATTTCTCCATTCTTGCCAACAACCCCATCATCAAGTAGCTTTGGA
JMFF009L09+ CCATTGTTGCCAACAATCCCATCATCAACTAGCTTTGGA
JMFF003O18+ CTTTGCCTTTTCAGGATTTCTCCATTGTTGCCAACAATCCCATCATCAACTAGCTTTGAA
JMSF041C14+ CTCTGTTTTCTCAGTATTTCTCCATTGTTGCCAACAATCCCATCTTCGATTAGCTTTGGA
                      ____________________________________________________________
consensus CTCTGCTTTCTCAGTATTTCTCCATTGTTGCCAACAATCCCATCATCAAGTAGCTTTGGA
 
. : . : . : . : . : . :
JMSF034O22+ ATATTGAACATCATGGTTAGAGTAGCAGCTGCAGCAGGCCAGAAAGCAGCTCGCTGGAGT
JMSF045F12+ ATATTGAACATCATGGTTAGAGTAGCAGCTGCAGCAGGCCAGAAAGCAGCTCGCTGGAGT
JMFF009L09+ ATATTAAACACCATGGGTAGTGAAGCAGCTGAAGCAGTCCAGAAAGCAACTGGCTGGAGT
JMFF003O18+ ACATTAAACGTCATGGCTAGTGAAGCAGCTGAAGCAGTCCAGAAAGCAACTCGCTGGAGT
JMSF041C14+ ACATTAAACATCATGGCTAGAGAAGCAGCTGCAGAAGACCAGAAAGCAACTGGGTGGAGT
                      ____________________________________________________________
consensus ATATTAAACATCATGGTTAGAGAAGCAGCTGCAGCAGTCCAGAAAGCAACTCGCTGGAGT
 
. : . : . : . : . : . :
JMSF034O22+ CCCAATTTTTTGGCCAAGTCAAGCGCCCAACCCAAATGTTGGTCGGCAATAACACACGAA
JMSF045F12+ CCCAATTTCTTGGCCAAGTCAAGCGCCCAACCCAAATGTTGGTCGGCAATAACACACGAA
JMFF009L09+ CCCAATTTCTTGGCCAAGTCAAGCGCCCAACCCAAATTTTCATCGGCAATAAGACACGAA
JMFF003O18+ CCCAATTTCTTGGCCAAGTCAAGCGCCCAACCCAAATTTTCATCGGCAATAACACATGAA
JMSF041C14+ CCCAATTTCTTGGCCAAGTCAAGCGCCCAACCCATATTTTCATCGGCAATAAAACACGAA
                      ____________________________________________________________
consensus CCCAATTTCTTGGCCAAGTCAAGCGCCCAACCCAAATTTTCATCGGCAATAACACACGAA
 
. : . : . : . : . : . :
JMSF034O22+ ACTCTGTTCTCAACCGACTCATTTATGTTATGAATGAGAGCCTCCAGCTTCCCTGGAACA
JMSF045F12+ ACTCTGTTCTCAACCGACTCATTTATGTTATGAATGAGAGCCTCCAGCTTCCCTGGAACA
JMFF009L09+ ACTCTGTTCTCATCCGACTCATTTATGTTATGAATGAGAGCCTCCAGCTTCCCTGGAACA
JMFF003O18+ ACTCTGTTCTCATCCGACTCATTTATGTTATGAATGAGAGCCTCCAGCTTCCCTGGAACA
JMSF041C14+ ACTCTGTTCTCAACCGACTCATTTATGTTATGAATGAGAGCCTCCAGCTTCCCTGGACCA
                      ____________________________________________________________
consensus ACTCTGTTCTCAACCGACTCATTTATGTTATGAATGAGAGCCTCCAGCTTCCCTGGAACA
 
. : . : . : . : . : . :
JMSF034O22+ ACCTCATGGAATGCGTCTAATAGCTTCTTCAGGTCATTCCTATCCTCCTCAGCTGCCAAC
JMSF045F12+ ACCTCATGGAATGCGTCTAATAGCTTCTTCAGGTCATTCCTATCCTCCTCAGCTGCCAAC
JMFF009L09+ ACCTCAAAGAATGCGTCTGTTAGCTTCTTCAGGTCATTCCTATCCTCCTCCGCTGCCAAC
JMFF003O18+ ACCTCAAAGAATGCTTCTGTTAGCTTCTTCAGGTCATTCCTATCCTCCTCCGATGCCAAC
JMSF041C14+ ACCTTAGAGAATGCTTCAGTTAGCTTGATCAGGTCATTCCGATCCTCCTCCACTGCCAAC
                      ____________________________________________________________
consensus ACCTCATAGAATGCGTCTGTTAGCTTCTTCAGGTCATTCCTATCCTCCTCCGCTGCCAAC
 
. : . : . : . : . : . :
JMSF034O22+ CCGTCAGGGACCGATACCAGGTTTATAACATTGTCTGCTTCAGACATGGATTCGATGATT
JMSF045F12+ CCGTCAGGGACCGATACCAGGTTTATAACATTGTCTGCTTCAGACATGGATTCGATGATT
JMFF009L09+ CCGTCAGGGACTGATACCAGGTTTATAGCATTGTCTGCCTCCGACATGGACTCCATGATT
JMSF008B10+ CTCCGACATGGACTCCATGATT
JMFF003O18+ CCGTCAGGGACTGATACCAGGTTTATAGCATTGTCTGCCTCCGACATGGACTCCATGATT
JMSF041C14+ CCGTCAGGGATCGATACCAGGTTTATAACGTTGTCTGCCTCCGACATGGACTCCATGATT
                      ____________________________________________________________
consensus CCGTCAGGGACCGATACCAGGTTTATAACATTGTCTGCCTCCGACATGGACTCCATGATT
 
. : . : . : . : . : . :
JMSF034O22+ CGGTTGTGGTTGAACTCAGAGTTGACGAAGGTGACTTTGCAGCCATGCTCGACTAAGCAC
JMSF045F12+ CGGTTGTGGTTGAACTCAGAGTTGACGAAGGTGACTTTGCAGCCATGCTCGACTAAGCAC
JMFF009L09+ CGCTTGTGGTTGAACTCAGTGTTCACAATGGTGACCTTGCACCCATGCTTGACTAAGCAC
JMSF008B10+ CGGTTGTGGTTGAACTCAGTGTTGACGAAGGTGACTTTGCAGCCATGCTTCACTAAGCAC
JMFF003O18+ CGCTTGTGGTTGAACTCAGAGTTGACGAAAGTGACTTTGCAGCCATGCTTCACTAAGCAC
JMSF041C14+ CGGTTGTGGGTGAAGTGAGAGTTGACGAAGGTGACTTTGCAGCCATGCTTCACTAAGCAC
                      ____________________________________________________________
consensus CGGTTGTGGTTGAACTCAGAGTTGACGAAGGTGACTTTGCAGCCATGCTTGACTAAGCAC
 
. : . : . : . : . : . :
JMSF034O22+ TGGCAAGGCTCCATTAAAGGGATAACATGGCCCTGTGCTGGATATGGTATGGCTAGGATA
JMSF045F12+ TGGCAAAGCTCCATTAAAGGGATAACATGGCCCTGTGCTGGATATGGTATGGCTAGGATA
JMFF009L09+ AGGCAAAGCTCC
JMSF008B10+ AGGCAAAGCTCCATTGTGGGGATAACATGGCCTTGTGCTGGATATGGTATGGCTAGGATA
JMFF003O18+ AGGCAAAGCTCCATTGTGGGGATAACATGGCCTTGTCCTGGATATGGTATGGCTATGATA
JMSF041C14+ TGGCAAAGCTCCATTAAAGGGATAACATGGCCTTGTGCTGGATATGGTATGGCTAGGATA
                      ____________________________________________________________
consensus TGGCAAAGCTCCATTAAAGGGATAACATGGCCTTGTGCTGGATATGGTATGGCTAGGATA
 
. : . : . : . : . : . :
JMSF034O22+ TGTGGCTTTCTCATCTTTAA
JMSF045F12+ TGTGGCTTTCTCATCTTTAA
JMSF008B10+ TGTGGCTTTCTCATCATTAA
JMFF003O18+ TGTGGCTTTCTCATCATTAAATG
JMSF041C14+ TGTGGCTTTGCCATCCTTAATTGCTTAGTTTTGATGCTCTAACTTTCGTCTTCAATTCCC
                      ____________________________________________________________
consensus TGTGGCTTTCTCATCTTTAATTGCTTAGTTTTGATGCTCTAACTTTCGTCTTCAATTCCC