Previous Contig 007390:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS022C09Sequence617007390 (4)pir|H86341|H863412e-04hypothetical protein F9H16.10 - Arabidopsis thaliana>gb:AE005172_891051 Arabidop
JMFS029E09Sequence577007390 (4)
JMSF041C02Sequence556007390 (4)755007390 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS022C09+ GATC
                      ____________________________________________________________
consensus GATC
 
. : . : . : . : . : . :
JMFS022C09+ AATTTCATCATCATCCATAGAAGCATCATTACCACCATTCTGTGAAATTTTTAAATCAGG
                      ____________________________________________________________
consensus AATTTCATCATCATCCATAGAAGCATCATTACCACCATTCTGTGAAATTTTTAAATCAGG
 
. : . : . : . : . : . :
JMFS022C09+ TACATCATTGGAACTTACAGAGCCAACTCCATCCACATCCAAAGGCTTAGCAAGTCCATC
                      ____________________________________________________________
consensus TACATCATTGGAACTTACAGAGCCAACTCCATCCACATCCAAAGGCTTAGCAAGTCCATC
 
. : . : . : . : . : . :
JMFS022C09+ CACATCCACATCCATATCCATATCCATATCCATGCCTTGTTTTTCCTCAAGAGCAGCATC
                      ____________________________________________________________
consensus CACATCCACATCCATATCCATATCCATATCCATGCCTTGTTTTTCCTCAAGAGCAGCATC
 
. : . : . : . : . : . :
JMFS022C09+ TTCATCATCAGATTCCCCTTCCAAAGTCCAAGTCTTGCCTGACTTGGGTTCATCAGTAAT
                      ____________________________________________________________
consensus TTCATCATCAGATTCCCCTTCCAAAGTCCAAGTCTTGCCTGACTTGGGTTCATCAGTAAT
 
. : . : . : . : . : . :
JMFS022C09+ TGCTGCAACTCCAAGCTTTTCTCTCTCTGACTCCTCCTTCTTTCTTCTCAACTCCTGCCA
                      ____________________________________________________________
consensus TGCTGCAACTCCAAGCTTTTCTCTCTCTGACTCCTCCTTCTTTCTTCTCAACTCCTGCCA
 
. : . : . : . : . : . :
JMFS022C09+ TTCCTGAACTCTCCTTCTTCGCTTCTCCATCTCTTCTTCCAGTTTCCTTTGTTCCTCAGC
                      ____________________________________________________________
consensus TTCCTGAACTCTCCTTCTTCGCTTCTCCATCTCTTCTTCCAGTTTCCTTTGTTCCTCAGC
 
. : . : . : . : . : . :
JMFS022C09+ TTGTTCTTCTTCTAGATTCTTCTGTTTCTTTTCTGATGATTCTTCATCACTTCTTCTCAG
                      ____________________________________________________________
consensus TTGTTCTTCTTCTAGATTCTTCTGTTTCTTTTCTGATGATTCTTCATCACTTCTTCTCAG
 
. : . : . : . : . : . :
JMFS022C09+ TGGGCTACCATCTTCACTGTCATCTCTGAGCTTAATAGGTTTCTTGCTTCGCTCATGATC
                      ____________________________________________________________
consensus TGGGCTACCATCTTCACTGTCATCTCTGAGCTTAATAGGTTTCTTGCTTCGCTCATGATC
 
. : . : . : . : . : . :
JMFS022C09+ CCTGCTCTTGTGATCATTCTCTCTCTTTCGCCTCTTTCTTTCACGATCTCTTACATCAAC
JMFS029E09+ TACATCAAC
                      ____________________________________________________________
consensus CCTGCTCTTGTGATCATTCTCTCTCTTTCGCCTCTTTCTTTCACGATCTCTTACATCAAC
 
. : . : . : . : . : . :
JMFS022C09+ ATCATCATCATCATCATCACTGCTATAATCACGCCTGCGCTCTTTCTCACGACCCCTCTT
JMFS029E09+ ATCATCATCATCATCATCACTGCTATAATCACGCCTGCGCTCTTTCTCACGACCCCTCTT
                      ____________________________________________________________
consensus ATCATCATCATCATCATCACTGCTATAATCACGCCTGCGCTCTTTCTCACGACCCCTCTT
 
. : . : . : . : . : . :
JMFS022C09+ CTCCCTACTCCTT
JMFS029E09+ CTCCCTACTCCTTTCCTTCTCCTCCTTATCTTTTTCCCTCCTATCTCTCTCTCTTCTCTC
                      ____________________________________________________________
consensus CTCCCTACTCCTTTCCTTCTCCTCCTTATCTTTTTCCCTCCTATCTCTCTCTCTTCTCTC
 
. : . : . : . : . : . :
JMFS029E09+ CCTTTCCTTATCCCTCTCCTTTTCTTTCTCTCTCTCCTTTTCTCTTTCACGTTCCCTCTC
rJMSF041C02- CTTTCCTTATCCCTCTCCTTTTCTTTCTCTCTCTCCTTTTCTCTTTCACGTTCCCTCTC
                      ____________________________________________________________
consensus CCTTTCCTTATCCCTCTCCTTTTCTTTCTCTCTCTCCTTTTCTCTTTCACGTTCCCTCTC
 
. : . : . : . : . : . :
JMFS029E09+ CTTCTCTTTCTCTCGGTCTCGATCCCTCTCCTTCTCTTTCTCTCTTTCGCGATCCTTCTC
rJMSF041C02- CTTCTCTTTCTCTCGGTCTCGATCCCTCTCCTTCTCTTTCTCTCTTTCGCGATCCTTCTC
                      ____________________________________________________________
consensus CTTCTCTTTCTCTCGGTCTCGATCCCTCTCCTTCTCTTTCTCTCTTTCGCGATCCTTCTC
 
. : . : . : . : . : . :
JMFS029E09+ CTTCTCCTTCTCTTTCTCTCTCTCCCTCTCTCTGTCTTCCTTCTCCCTAGCACTCTCTCT
rJMSF041C02- CTTCTCCTTCTCTTTCTCTCTCTCCCTCTCTCTGTCTTCCTTCTCCCTAGCACTCTCTCT
                      ____________________________________________________________
consensus CTTCTCCTTCTCTTTCTCTCTCTCCCTCTCTCTGTCTTCCTTCTCCCTAGCACTCTCTCT
 
. : . : . : . : . : . :
JMFS029E09+ GTCAGACCTATCCTTTTCTCTGTCTTTAGAGACCTTATCTCTGCTGCTCTTTTCCCTCTC
rJMSF041C02- GTCAGACCTATCCTTTTCTCTGTCTTTAGAGACCTTATCTCTGCTGCTCTTTTCCCTCTC
JMSF041C02+ TTTCCCTCTC
                      ____________________________________________________________
consensus GTCAGACCTATCCTTTTCTCTGTCTTTAGAGACCTTATCTCTGCTGCTCTTTTCCCTCTC
 
. : . : . : . : . : . :
JMFS029E09+ TTTCTCTTTATGCCTATCCTTGTGTTTTTCCTTTTCCCTATCTCTATTTCTCTCCCTATA
rJMSF041C02- TTTCTCTTTATGCCTATCCTTGTGTTTTTCCTTTTCCCTATCTCTATTTCTCTCCCTATA
JMSF041C02+ TTTCTCTTTATGCCTATCCTTGTGTTTTTCCTTTTCCCTATCTCTATTTCTCTCCCTATA
                      ____________________________________________________________
consensus TTTCTCTTTATGCCTATCCTTGTGTTTTTCCTTTTCCCTATCTCTATTTCTCTCCCTATA
 
. : . : . : . : . : . :
JMFS029E09+ CTTATCATCAGTACTCTTCTCCCTATCATGGCGGTCTTTCTTGTCACGGTAGTGTTCCCT
rJMSF041C02- CTTATCATCAGTACTCTTCTCCCTATCATGGCGGTCTTTCTTGTCACGGTAGTGTTCCCT
JMSF041C02+ CTTATCATCAGTACTCTTCTCCCTATCATGGCGGTCTTTCTTGTCACGGTAGTGTTCCCT
                      ____________________________________________________________
consensus CTTATCATCAGTACTCTTCTCCCTATCATGGCGGTCTTTCTTGTCACGGTAGTGTTCCCT
 
. : . : . : . : . : . :
JMFS029E09+ GTCTCTTTCCCTGTGCCTCTCTCCATTCTTCTCCTTATCACGGTCTCGGTGCTCATCTCT
rJMSF041C02- GTCTCTTTCCCTGTGCCTCTCTCCATTCTTCTCCTTATCACGGTCTCGGTGCTCATCTCT
JMSF041C02+ GTCTCTTTCCCTGTGCCTCTCTCCATTCTTCTCCTTATCACGGTCTCGGTGCTCATCTCT
                      ____________________________________________________________
consensus GTCTCTTTCCCTGTGCCTCTCTCCATTCTTCTCCTTATCACGGTCTCGGTGCTCATCTCT
 
. : . : . : . : . : . :
JMFS029E09+ GTCACGGTGGCTCCTCCTCCTTGGCTCT
rJMSF041C02- GTCACGGTGGCTCCTCCTCCTTGGCTCTTCTACTTCCTTTTCAGAGTCCTCCCTCTTAGA
JMSF041C02+ GTCACGGTGGCTCCTCCTCCTTGGCTCTTCTACTTCCTTTTCAGAGTCCTCCCTCTTAGA
                      ____________________________________________________________
consensus GTCACGGTGGCTCCTCCTCCTTGGCTCTTCTACTTCCTTTTCAGAGTCCTCCCTCTTAGA
 
. : . : . : . : . : . :
rJMSF041C02- AGACTTCTGCTTTGGTTCTTCCATACTAAATCAACAAGAGAAACCAACTGACAAAACCAA
JMSF041C02+ AGACTTCTGCTTTGGTTCTTCCATACTAAATCAACAAGAGAAACCAACTGACAAAACCAA
                      ____________________________________________________________
consensus AGACTTCTGCTTTGGTTCTTCCATACTAAATCAACAAGAGAAACCAACTGACAAAACCAA
 
. : . : . : . : . : . :
rJMSF041C02- GTAACCCAAGTTTCACTACGAAACAACTGCAAAACCTGTCTTACCGATCTGCAGAGCAAG
JMSF041C02+ GTAACCCAAGTTTCACTACGAAACAACTGCAAAACCTGTCTTACCGATCTGCAGAGCAAG
                      ____________________________________________________________
consensus GTAACCCAAGTTTCACTACGAAACAACTGCAAAACCTGTCTTACCGATCTGCAGAGCAAG
 
. : . : . : . : . : . :
rJMSF041C02- CTTTTACACAAGAGCCTCAACCATTTACAAGCAACCTAAGAATTCAAACGTGAACGGAGA
JMSF041C02+ CTTTTACACAAGAGCCTCAACCATTTACAAGCAACCTAAGAATTCAAACGTGAACGGAGA
                      ____________________________________________________________
consensus CTTTTACACAAGAGCCTCAACCATTTACAAGCAACCTAAGAATTCAAACGTGAACGGAGA
 
. : . : . : . : . : . :
rJMSF041C02- CAACGAAGCGGCTCGGCGAGGAGAAATTTGTGCTACTTGAAACCTTCCTGGCCTTCTCNA
JMSF041C02+ CAACGAAGCGGCTCGGCGAGGAGAAATTTGTGCTACTTGAAACCTTCCTGGCCTTCTCCA
                      ____________________________________________________________
consensus CAACGAAGCGGCTCGGCGAGGAGAAATTTGTGCTACTTGAAACCTTCCTGGCCTTCTCCA
 
. : . : . : . : . : . :
rJMSF041C02- GAAGCTTTCCAATAAGAGATTCGTCGAGAGCT
JMSF041C02+ GAAGCTTTCCAATAAGAGATTCGTCGAGAGCTTAGGTGAATCTGAATTCTTCGCTCAATC
                      ____________________________________________________________
consensus GAAGCTTTCCAATAAGAGATTCGTCGAGAGCTTAGGTGAATCTGAATTCTTCGCTCAATC