Previous Contig 007389:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF041B21Sequence458007389 (3)gb:AF204925_17767006e-06Petroselinum crispum transcription factor WRKY4 (WRKY4) mRNA, complete cds.406007389 (3)gb:AF204925_17767006e-06Petroselinum crispum transcription factor WRKY4 (WRKY4) mRNA, complete cds.
JMSF041B23Sequence190007389 (3)gb:AY484579_16083140.001Vitis aestivalis putative WRKY4 transcription factor mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041B21+ TTTTTTTTTTAAGCTCCAATTCAAGTTTGTTACCCTAG
                      ____________________________________________________________
consensus TTTTTTTTTTAAGCTCCAATTCAAGTTTGTTACCCTAG
 
. : . : . : . : . : . :
rJMSF041B21- AATTTACATTGTTTCTTTTCATTGAGCCAATTTTTGTTTTCCTATT
JMSF041B21+ TTTGGCATTCAACAAATTTACATTGTTTCTTTTCATTGAGCCAATTTTTGTTTTCCTATT
                      ____________________________________________________________
consensus TTTGGCATTCAACAAATTTACATTGTTTCTTTTCATTGAGCCAATTTTTGTTTTCCTATT
 
. : . : . : . : . : . :
rJMSF041B21- CTAATATCACACGAGTATTTCACTCCGGCCAACAAAGTTTAATTTGATGCACCGTTATTA
JMSF041B21+ CTAATATCACACGAGTATTTCACTCCGGCCAACAAAGTTTAATTTGATGCACCGTTATTA
                      ____________________________________________________________
consensus CTAATATCACACGAGTATTTCACTCCGGCCAACAAAGTTTAATTTGATGCACCGTTATTA
 
. : . : . : . : . : . :
rJMSF041B21- TTAATATTTTTGTACACTTTAATGTACTAAACTATGTTGAAGGATGGAATCATCAGCATG
JMSF041B21+ TTAATATTTTTGTACACTTTAATGTACTAAACTATGTTGAAGGATGGAATCATCAGCATG
                      ____________________________________________________________
consensus TTAATATTTTTGTACACTTTAATGTACTAAACTATGTTGAAGGATGGAATCATCAGCATG
 
. : . : . : . : . : . :
rJMSF041B21- AATCTGCCAGCGCATGGTCGACGAGAATTCTGTCGGAAATCGCCGCCGCCAGCGCATTCG
JMSF041B23+ GCCAGCGCATGGTCGACGAGAATTCTGTCGGAAATCNCCGCCGCCAGCGCATTCG
JMSF041B21+ AATCTGCCAGCGCATGGTCGACGAGAATTCTGTCGGAAATCGCCGCCGCCAGCGCATTCG
                      ____________________________________________________________
consensus AATCTGCCAGCGCATGGTCGACGAGAATTCTGTCGGAAATCGCCGCCGCCAGCGCATTCG
 
. : . : . : . : . : . :
rJMSF041B21- TGAAGCCCCGGTTTTTGGTCAAAGAAGAAGCCATTTTCTCAGCCAAAAAGTGTTGGAGTT
JMSF041B23+ NGAAGCCCCGGTTTTTGGTCAAAGAAGAAGCCATTTTCTCAGCCAAAAAGTGTTGGAGTT
JMSF041B21+ TGAAGCCCCGGTTTTTGGTCAAAGAAGAAGCCATTTTCTCAGCCAAAAAGTGTTGGAGTT
                      ____________________________________________________________
consensus TGAAGCCCCGGTTTTTGGTCAAAGAAGAAGCCATTTTCTCAGCCAAAAAGTGTTGGAGTT
 
. : . : . : . : . : . :
rJMSF041B21- CCACTGTATCAAGTGAAGTAAGAGATCTCTGAACTTTGGCCCGAATATCCAATCGGGCCG
JMSF041B23+ CCACNGTATCAAGNGAAGTAAGAGATCTNTGAACTTTGGCCCGAATATCCAATCGGGCCG
JMSF041B21+ CCACTGTATCAAGTGAAGTAAGAGATCTCTGAACTTTGGCCCGAATATCCAATCGGGCCG
                      ____________________________________________________________
consensus CCACTGTATCAAGTGAAGTAAGAGATCTCTGAACTTTGGCCCGAATATCCAATCGGGCCG
 
. : . : . : . : . : . :
rJMSF041B21- GGCTCGAAGAATTCTCTACATCTGAAACCGGGGCAGATTGATTGAGGTGTGAAGCCTTGC
JMSF041B23+ GGCT
JMSF041B21+ GGCTCGAAGAATTCTCTACATCTGAAACCGGGGCAGATTGATTGAGGTGTGAAGCCTTGC
                      ____________________________________________________________
consensus GGCTCGAAGAATTCTCTACATCTGAAACCGGGGCAGATTGATTGAGGTGTGAAGCCTTGC